ID: 1007816127

View in Genome Browser
Species Human (GRCh38)
Location 6:44526882-44526904
Sequence GGGGTTTATTAAACCATCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007816119_1007816127 21 Left 1007816119 6:44526838-44526860 CCTTAATGAATGGGGTTATTAGG No data
Right 1007816127 6:44526882-44526904 GGGGTTTATTAAACCATCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007816127 Original CRISPR GGGGTTTATTAAACCATCAA GGG Intergenic
No off target data available for this crispr