ID: 1007818960

View in Genome Browser
Species Human (GRCh38)
Location 6:44545850-44545872
Sequence CAGTGGTAATAGAGGGAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007818960_1007818964 9 Left 1007818960 6:44545850-44545872 CCAGATTCCCTCTATTACCACTG No data
Right 1007818964 6:44545882-44545904 AAATAAAACACATTTCATCAAGG No data
1007818960_1007818965 29 Left 1007818960 6:44545850-44545872 CCAGATTCCCTCTATTACCACTG No data
Right 1007818965 6:44545902-44545924 AGGCCACAATTTCTTGCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007818960 Original CRISPR CAGTGGTAATAGAGGGAATC TGG (reversed) Intergenic
No off target data available for this crispr