ID: 1007819484

View in Genome Browser
Species Human (GRCh38)
Location 6:44550518-44550540
Sequence TTGTTTTGGGAGAGGGAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007819484_1007819495 29 Left 1007819484 6:44550518-44550540 CCGTCTTCCCTCTCCCAAAACAA No data
Right 1007819495 6:44550570-44550592 CTTTCATACACACATGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007819484 Original CRISPR TTGTTTTGGGAGAGGGAAGA CGG (reversed) Intergenic
No off target data available for this crispr