ID: 1007819495

View in Genome Browser
Species Human (GRCh38)
Location 6:44550570-44550592
Sequence CTTTCATACACACATGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007819489_1007819495 15 Left 1007819489 6:44550532-44550554 CCAAAACAAGTCCCCACGGCAAT No data
Right 1007819495 6:44550570-44550592 CTTTCATACACACATGCCCCAGG No data
1007819486_1007819495 21 Left 1007819486 6:44550526-44550548 CCTCTCCCAAAACAAGTCCCCAC No data
Right 1007819495 6:44550570-44550592 CTTTCATACACACATGCCCCAGG No data
1007819492_1007819495 2 Left 1007819492 6:44550545-44550567 CCACGGCAATGATCCTGCATGTC No data
Right 1007819495 6:44550570-44550592 CTTTCATACACACATGCCCCAGG No data
1007819491_1007819495 3 Left 1007819491 6:44550544-44550566 CCCACGGCAATGATCCTGCATGT No data
Right 1007819495 6:44550570-44550592 CTTTCATACACACATGCCCCAGG No data
1007819490_1007819495 4 Left 1007819490 6:44550543-44550565 CCCCACGGCAATGATCCTGCATG No data
Right 1007819495 6:44550570-44550592 CTTTCATACACACATGCCCCAGG No data
1007819488_1007819495 16 Left 1007819488 6:44550531-44550553 CCCAAAACAAGTCCCCACGGCAA No data
Right 1007819495 6:44550570-44550592 CTTTCATACACACATGCCCCAGG No data
1007819485_1007819495 22 Left 1007819485 6:44550525-44550547 CCCTCTCCCAAAACAAGTCCCCA No data
Right 1007819495 6:44550570-44550592 CTTTCATACACACATGCCCCAGG No data
1007819484_1007819495 29 Left 1007819484 6:44550518-44550540 CCGTCTTCCCTCTCCCAAAACAA No data
Right 1007819495 6:44550570-44550592 CTTTCATACACACATGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007819495 Original CRISPR CTTTCATACACACATGCCCC AGG Intergenic
No off target data available for this crispr