ID: 1007820350

View in Genome Browser
Species Human (GRCh38)
Location 6:44556165-44556187
Sequence TCCTAGAGGCAGAAGGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007820345_1007820350 17 Left 1007820345 6:44556125-44556147 CCAGGCAGGAATTTGGTGTGGGT No data
Right 1007820350 6:44556165-44556187 TCCTAGAGGCAGAAGGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007820350 Original CRISPR TCCTAGAGGCAGAAGGTGCA AGG Intergenic
No off target data available for this crispr