ID: 1007822422

View in Genome Browser
Species Human (GRCh38)
Location 6:44570488-44570510
Sequence CCTGCAATGCAGGCTGTCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007822422_1007822427 -3 Left 1007822422 6:44570488-44570510 CCATAGACAGCCTGCATTGCAGG No data
Right 1007822427 6:44570508-44570530 AGGCTAGAGGGATTGCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007822422 Original CRISPR CCTGCAATGCAGGCTGTCTA TGG (reversed) Intergenic
No off target data available for this crispr