ID: 1007822624

View in Genome Browser
Species Human (GRCh38)
Location 6:44571846-44571868
Sequence GGGAATAAGACAAAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007822615_1007822624 29 Left 1007822615 6:44571794-44571816 CCTGGAGGAGGTAAGGTTGAATG No data
Right 1007822624 6:44571846-44571868 GGGAATAAGACAAAGGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007822624 Original CRISPR GGGAATAAGACAAAGGTGGG TGG Intergenic
No off target data available for this crispr