ID: 1007825256

View in Genome Browser
Species Human (GRCh38)
Location 6:44595235-44595257
Sequence GGTCAGCAGGACAATGGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007825256_1007825264 17 Left 1007825256 6:44595235-44595257 CCTACACCATTGTCCTGCTGACC No data
Right 1007825264 6:44595275-44595297 TGGTCACTCAAGTCTACTCCCGG No data
1007825256_1007825261 -3 Left 1007825256 6:44595235-44595257 CCTACACCATTGTCCTGCTGACC No data
Right 1007825261 6:44595255-44595277 ACCTGGTTCTTGGTGAAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007825256 Original CRISPR GGTCAGCAGGACAATGGTGT AGG (reversed) Intergenic
No off target data available for this crispr