ID: 1007825413

View in Genome Browser
Species Human (GRCh38)
Location 6:44596191-44596213
Sequence CTAAGGATATGGAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007825413_1007825422 4 Left 1007825413 6:44596191-44596213 CCTTCCTCCCTCCATATCCTTAG No data
Right 1007825422 6:44596218-44596240 AAAGCAGACTTGGGACCCTTTGG No data
1007825413_1007825426 15 Left 1007825413 6:44596191-44596213 CCTTCCTCCCTCCATATCCTTAG No data
Right 1007825426 6:44596229-44596251 GGGACCCTTTGGAGTTGAGGGGG No data
1007825413_1007825425 14 Left 1007825413 6:44596191-44596213 CCTTCCTCCCTCCATATCCTTAG No data
Right 1007825425 6:44596228-44596250 TGGGACCCTTTGGAGTTGAGGGG No data
1007825413_1007825429 30 Left 1007825413 6:44596191-44596213 CCTTCCTCCCTCCATATCCTTAG No data
Right 1007825429 6:44596244-44596266 TGAGGGGGTGCCCTTGTGTGAGG No data
1007825413_1007825424 13 Left 1007825413 6:44596191-44596213 CCTTCCTCCCTCCATATCCTTAG No data
Right 1007825424 6:44596227-44596249 TTGGGACCCTTTGGAGTTGAGGG No data
1007825413_1007825420 -5 Left 1007825413 6:44596191-44596213 CCTTCCTCCCTCCATATCCTTAG No data
Right 1007825420 6:44596209-44596231 CTTAGCCTCAAAGCAGACTTGGG No data
1007825413_1007825419 -6 Left 1007825413 6:44596191-44596213 CCTTCCTCCCTCCATATCCTTAG No data
Right 1007825419 6:44596208-44596230 CCTTAGCCTCAAAGCAGACTTGG No data
1007825413_1007825423 12 Left 1007825413 6:44596191-44596213 CCTTCCTCCCTCCATATCCTTAG No data
Right 1007825423 6:44596226-44596248 CTTGGGACCCTTTGGAGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007825413 Original CRISPR CTAAGGATATGGAGGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr