ID: 1007825505

View in Genome Browser
Species Human (GRCh38)
Location 6:44597173-44597195
Sequence CCTCATACACTGCTGGTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007825505_1007825512 29 Left 1007825505 6:44597173-44597195 CCCCCTACCAGCAGTGTATGAGG No data
Right 1007825512 6:44597225-44597247 TTTGAGACAGCCTGTTGCCCAGG 0: 11
1: 19
2: 58
3: 156
4: 663

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007825505 Original CRISPR CCTCATACACTGCTGGTAGG GGG (reversed) Intergenic
No off target data available for this crispr