ID: 1007833965

View in Genome Browser
Species Human (GRCh38)
Location 6:44660065-44660087
Sequence AGCCAAGGTCATTCGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007833965_1007833969 15 Left 1007833965 6:44660065-44660087 CCTGGCTCCGAATGACCTTGGCT No data
Right 1007833969 6:44660103-44660125 TCTACTCTGCTCATCCGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007833965 Original CRISPR AGCCAAGGTCATTCGGAGCC AGG (reversed) Intergenic
No off target data available for this crispr