ID: 1007834363

View in Genome Browser
Species Human (GRCh38)
Location 6:44663430-44663452
Sequence ACTCCCAGCGCCCAGAGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007834363_1007834369 22 Left 1007834363 6:44663430-44663452 CCACTGCTCTGGGCGCTGGGAGT No data
Right 1007834369 6:44663475-44663497 CAGCCTTCAAGAAGTTTATGTGG No data
1007834363_1007834370 23 Left 1007834363 6:44663430-44663452 CCACTGCTCTGGGCGCTGGGAGT No data
Right 1007834370 6:44663476-44663498 AGCCTTCAAGAAGTTTATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007834363 Original CRISPR ACTCCCAGCGCCCAGAGCAG TGG (reversed) Intergenic