ID: 1007837940

View in Genome Browser
Species Human (GRCh38)
Location 6:44690370-44690392
Sequence CTGAATCTCTGTGCTTTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007837939_1007837940 6 Left 1007837939 6:44690341-44690363 CCTCAAAATTTAGGAACAAATAT No data
Right 1007837940 6:44690370-44690392 CTGAATCTCTGTGCTTTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007837940 Original CRISPR CTGAATCTCTGTGCTTTTAA TGG Intergenic
No off target data available for this crispr