ID: 1007840520

View in Genome Browser
Species Human (GRCh38)
Location 6:44712380-44712402
Sequence GAGGCCTCCCGTACATCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007840520_1007840530 26 Left 1007840520 6:44712380-44712402 CCTGGAGATGTACGGGAGGCCTC No data
Right 1007840530 6:44712429-44712451 CCATGGCAGAGCAGGGGGCTTGG No data
1007840520_1007840528 21 Left 1007840520 6:44712380-44712402 CCTGGAGATGTACGGGAGGCCTC No data
Right 1007840528 6:44712424-44712446 AAAAACCATGGCAGAGCAGGGGG No data
1007840520_1007840525 18 Left 1007840520 6:44712380-44712402 CCTGGAGATGTACGGGAGGCCTC No data
Right 1007840525 6:44712421-44712443 GCTAAAAACCATGGCAGAGCAGG No data
1007840520_1007840523 9 Left 1007840520 6:44712380-44712402 CCTGGAGATGTACGGGAGGCCTC No data
Right 1007840523 6:44712412-44712434 AGAACCACAGCTAAAAACCATGG No data
1007840520_1007840526 19 Left 1007840520 6:44712380-44712402 CCTGGAGATGTACGGGAGGCCTC No data
Right 1007840526 6:44712422-44712444 CTAAAAACCATGGCAGAGCAGGG No data
1007840520_1007840527 20 Left 1007840520 6:44712380-44712402 CCTGGAGATGTACGGGAGGCCTC No data
Right 1007840527 6:44712423-44712445 TAAAAACCATGGCAGAGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007840520 Original CRISPR GAGGCCTCCCGTACATCTCC AGG (reversed) Intergenic
No off target data available for this crispr