ID: 1007841600

View in Genome Browser
Species Human (GRCh38)
Location 6:44720536-44720558
Sequence CCCATTAGCTCCCATGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007841600_1007841608 27 Left 1007841600 6:44720536-44720558 CCTTGCTCATGGGAGCTAATGGG No data
Right 1007841608 6:44720586-44720608 ACATGTGCCACAAAATGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007841600 Original CRISPR CCCATTAGCTCCCATGAGCA AGG (reversed) Intergenic
No off target data available for this crispr