ID: 1007842842

View in Genome Browser
Species Human (GRCh38)
Location 6:44730799-44730821
Sequence CAGGGGGGCTGGAGGGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007842842_1007842852 8 Left 1007842842 6:44730799-44730821 CCTACTTCCCTCCAGCCCCCCTG No data
Right 1007842852 6:44730830-44730852 CAGAGCCCTCTGTCTTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007842842 Original CRISPR CAGGGGGGCTGGAGGGAAGT AGG (reversed) Intergenic
No off target data available for this crispr