ID: 1007843010

View in Genome Browser
Species Human (GRCh38)
Location 6:44731981-44732003
Sequence CTGTGTGTAGAGAGTGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007843008_1007843010 6 Left 1007843008 6:44731952-44731974 CCAAAGTCTCTCTTTGGGACACT No data
Right 1007843010 6:44731981-44732003 CTGTGTGTAGAGAGTGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007843010 Original CRISPR CTGTGTGTAGAGAGTGGTGC AGG Intergenic
No off target data available for this crispr