ID: 1007843225

View in Genome Browser
Species Human (GRCh38)
Location 6:44733679-44733701
Sequence AGTCACCCACTGCCAAGTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007843225_1007843227 -2 Left 1007843225 6:44733679-44733701 CCCTAACTTGGCAGTGGGTGACT No data
Right 1007843227 6:44733700-44733722 CTTGACTTCCTCACATGCTCTGG No data
1007843225_1007843228 1 Left 1007843225 6:44733679-44733701 CCCTAACTTGGCAGTGGGTGACT No data
Right 1007843228 6:44733703-44733725 GACTTCCTCACATGCTCTGGAGG No data
1007843225_1007843229 5 Left 1007843225 6:44733679-44733701 CCCTAACTTGGCAGTGGGTGACT No data
Right 1007843229 6:44733707-44733729 TCCTCACATGCTCTGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007843225 Original CRISPR AGTCACCCACTGCCAAGTTA GGG (reversed) Intergenic
No off target data available for this crispr