ID: 1007843921

View in Genome Browser
Species Human (GRCh38)
Location 6:44738634-44738656
Sequence CAGGGTAAAAAGATGGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007843916_1007843921 -5 Left 1007843916 6:44738616-44738638 CCTCAGTGTGAAAACTAACAGGG No data
Right 1007843921 6:44738634-44738656 CAGGGTAAAAAGATGGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007843921 Original CRISPR CAGGGTAAAAAGATGGGGCC TGG Intergenic
No off target data available for this crispr