ID: 1007847120

View in Genome Browser
Species Human (GRCh38)
Location 6:44768498-44768520
Sequence AACTCTTTCTTGAAGAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007847120_1007847124 22 Left 1007847120 6:44768498-44768520 CCCTCACTCTTCAAGAAAGAGTT No data
Right 1007847124 6:44768543-44768565 CTAGACCTTTAACCAAAGAGTGG No data
1007847120_1007847125 23 Left 1007847120 6:44768498-44768520 CCCTCACTCTTCAAGAAAGAGTT No data
Right 1007847125 6:44768544-44768566 TAGACCTTTAACCAAAGAGTGGG No data
1007847120_1007847126 26 Left 1007847120 6:44768498-44768520 CCCTCACTCTTCAAGAAAGAGTT No data
Right 1007847126 6:44768547-44768569 ACCTTTAACCAAAGAGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007847120 Original CRISPR AACTCTTTCTTGAAGAGTGA GGG (reversed) Intergenic
No off target data available for this crispr