ID: 1007850630

View in Genome Browser
Species Human (GRCh38)
Location 6:44799350-44799372
Sequence GCTGAAACCCAGTCTGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007850630_1007850631 1 Left 1007850630 6:44799350-44799372 CCTGTTTCAGACTGGGTTTCAGC No data
Right 1007850631 6:44799374-44799396 CAAATTTATCGCATGCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007850630 Original CRISPR GCTGAAACCCAGTCTGAAAC AGG (reversed) Intergenic
No off target data available for this crispr