ID: 1007851284

View in Genome Browser
Species Human (GRCh38)
Location 6:44804906-44804928
Sequence GCCTCACACCTTGCTCTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007851282_1007851284 -9 Left 1007851282 6:44804892-44804914 CCTAGAACCAAACAGCCTCACAC No data
Right 1007851284 6:44804906-44804928 GCCTCACACCTTGCTCTTACAGG No data
1007851280_1007851284 11 Left 1007851280 6:44804872-44804894 CCAGGTCCTGTTTGCTGCTGCCT No data
Right 1007851284 6:44804906-44804928 GCCTCACACCTTGCTCTTACAGG No data
1007851281_1007851284 5 Left 1007851281 6:44804878-44804900 CCTGTTTGCTGCTGCCTAGAACC No data
Right 1007851284 6:44804906-44804928 GCCTCACACCTTGCTCTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007851284 Original CRISPR GCCTCACACCTTGCTCTTAC AGG Intergenic
No off target data available for this crispr