ID: 1007854050

View in Genome Browser
Species Human (GRCh38)
Location 6:44835651-44835673
Sequence TACTCAGTTGAGCCACCGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 31}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007854048_1007854050 0 Left 1007854048 6:44835628-44835650 CCTAAATGTCTGGTTTATTGGAA 0: 1
1: 0
2: 1
3: 24
4: 248
Right 1007854050 6:44835651-44835673 TACTCAGTTGAGCCACCGTTGGG 0: 1
1: 0
2: 0
3: 2
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007854050 Original CRISPR TACTCAGTTGAGCCACCGTT GGG Intronic
903424975 1:23246712-23246734 TTTTCAGATGAGCCACCATTTGG - Intergenic
909969378 1:81961256-81961278 TACTCAGCTGAGCCACATATTGG + Intronic
921600997 1:217106318-217106340 TTCTCTGTTCAGCCACCATTCGG + Intronic
924287201 1:242499939-242499961 ATCCCAGTTGAGCCCCCGTTTGG - Intronic
1072324871 10:94288033-94288055 TACCCAGTTGTTCCACAGTTAGG + Intronic
1076922273 10:133460164-133460186 TGCTCAGGTGAGCGGCCGTTGGG + Intergenic
1079860826 11:25669284-25669306 TTATCATTTTAGCCACCGTTAGG + Intergenic
1105603633 13:21909341-21909363 CACTCAGTGGAGTCACTGTTTGG + Intergenic
1106955503 13:34934108-34934130 TTCTCAGTTGAGCTAGAGTTTGG + Intergenic
1111996089 13:95167512-95167534 TCCTCAGTGGACCCACCTTTTGG - Intronic
1146701603 17:34965682-34965704 TACTCACGTGAACCCCCGTTGGG + Intronic
1149597025 17:57870248-57870270 TACTGGGTTGAGCCACAGCTGGG - Intronic
1153808037 18:8726895-8726917 TACTGAGTACAGTCACCGTTCGG - Intronic
925251087 2:2439199-2439221 TACTCAGTAGTGGAACCGTTGGG - Intergenic
935657670 2:105438720-105438742 TTCCCAGTTTAGCCACCCTTTGG - Intergenic
1179119486 21:38529591-38529613 TACTCTGTTGAGCCTCCTATAGG - Intronic
1182548462 22:31088907-31088929 TCCTCTCTTGAGCCACTGTTGGG - Exonic
949368273 3:3306727-3306749 TACCCAGTTGAGCATCCCTTTGG - Intergenic
965365019 3:167787515-167787537 TACTGATTTCAGCCACCGTTGGG - Intronic
973827791 4:54725897-54725919 AACTCATCTGGGCCACCGTTTGG + Exonic
982251900 4:153415573-153415595 TACTGAGTTCAGTCACTGTTGGG - Intergenic
989105570 5:37860082-37860104 TGCTCAGTTTAGCCACTGTTTGG + Intergenic
993603599 5:89959117-89959139 TATTCAGATGAGCCAAAGTTTGG + Intergenic
1006824799 6:36926887-36926909 GACTCAGATGTGCCTCCGTTGGG + Intronic
1007854050 6:44835651-44835673 TACTCAGTTGAGCCACCGTTGGG + Intronic
1016805499 6:148208082-148208104 TCATCAGCTGAGCCCCCGTTTGG + Intergenic
1021636101 7:22695320-22695342 TTCTCACTTGATCCACAGTTTGG + Intergenic
1028796718 7:94910710-94910732 CACTCAGTTGACTCACAGTTGGG - Exonic
1043843767 8:85140785-85140807 TACAGAGGTGAGCCACCATTTGG - Intronic
1048691994 8:136976705-136976727 TACTAAGATAAGCCACCTTTAGG + Intergenic
1052288623 9:26817536-26817558 TCCTAAGTTGAACCACGGTTGGG + Intergenic
1056658274 9:88526462-88526484 TTCTCAGTTGGGCCACCATGAGG - Intergenic
1186437102 X:9552089-9552111 TCCTCAGATGGGCCACCCTTTGG + Intronic
1190418164 X:50201318-50201340 TACTGAGTTTAGCCCCAGTTTGG + Intergenic