ID: 1007855743

View in Genome Browser
Species Human (GRCh38)
Location 6:44854632-44854654
Sequence GTGCAGAAGCTGAATGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 228}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007855743 Original CRISPR GTGCAGAAGCTGAATGGAGC TGG (reversed) Intronic
900196227 1:1376972-1376994 CTACAGGAGCTGCATGGAGCCGG + Intergenic
900393165 1:2442649-2442671 GTGCAGAAGCAGCATGGTGTGGG + Intronic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
900979109 1:6036076-6036098 GGGCAGAGGCTGATTGGAGTTGG + Intronic
902799254 1:18819323-18819345 GGGCAGGAGCTGGATGGGGCAGG - Intergenic
903406240 1:23098971-23098993 GGGCAGAATCTGAATGGAAGCGG - Intronic
904272228 1:29357535-29357557 GGGCAGAAGCTGAGAAGAGCAGG - Intergenic
906149357 1:43578511-43578533 TGGCAGAAACTGAATGGAGCTGG + Intronic
907290048 1:53407798-53407820 CAGCAGAAGGTGAAGGGAGCAGG - Intergenic
909981561 1:82108009-82108031 GTGCAGCAGCTCAATGTAGGGGG - Intergenic
911046041 1:93629223-93629245 GTGCCCAGGCTGACTGGAGCAGG - Intronic
914421667 1:147533744-147533766 GTGCAGAAGCTTAACTGAACAGG + Intergenic
915367786 1:155325170-155325192 GTGCAGAAGGTGAAGGTGGCTGG + Exonic
915740712 1:158116459-158116481 GAGCAGAAGCCAAATGGAGAAGG + Intergenic
916523017 1:165581930-165581952 GTGCAGAAGCAGACCGGAGCCGG + Intergenic
916987501 1:170207465-170207487 GTCCTGAGGCTGCATGGAGCAGG - Intergenic
917968912 1:180195026-180195048 TTAAAGGAGCTGAATGGAGCAGG + Intronic
918528056 1:185486584-185486606 CTGGAGAAGTGGAATGGAGCGGG + Intergenic
920722169 1:208398015-208398037 ATGCAAAAACTGAATGGGGCAGG + Intergenic
920964693 1:210692090-210692112 GTGCAGATGCTGCATGGTGGTGG - Intronic
922616524 1:226964343-226964365 GTTCAGAAGCAGAAAGGACCTGG + Intronic
924442989 1:244102368-244102390 GTGCAGAAGGAGAATGCTGCTGG - Intergenic
1063820435 10:9828838-9828860 GTGGAGAATCTGAAAGGAGTGGG + Intergenic
1063894057 10:10660514-10660536 TAGCAGCTGCTGAATGGAGCGGG - Intergenic
1067456025 10:46419804-46419826 GAGCCCAAGCTGAATGGAGGAGG + Intergenic
1067631175 10:47964835-47964857 GAGCCCAAGCTGAATGGAGGAGG - Intergenic
1068600695 10:58953504-58953526 GTGCAGGAGCTAAAAGAAGCTGG + Intergenic
1069566445 10:69466402-69466424 GTGCACAAGATGATTGTAGCTGG + Intronic
1069725422 10:70574481-70574503 GTGCAGAGGCAGAATGAACCTGG + Intergenic
1069806886 10:71131862-71131884 GAGCAGAGGCTGCATGGAGGTGG - Intergenic
1073073023 10:100806626-100806648 TTGCAGAAGTAGAAAGGAGCCGG + Intronic
1078891476 11:15561824-15561846 ATGCAGAAGCTGACTCAAGCGGG - Intergenic
1081489696 11:43557882-43557904 GTGGAGAAGCTAAATGGGGCAGG + Intronic
1082649624 11:55773231-55773253 GTTCAGAAGGTTGATGGAGCTGG + Intergenic
1084558629 11:69890266-69890288 CTGCTGAGGCTGGATGGAGCTGG + Intergenic
1086797727 11:91129167-91129189 GTGCAAAAACTTAATGGAGTGGG + Intergenic
1087218839 11:95523905-95523927 GTGAAGGAGCTGAGTGGCGCCGG + Intergenic
1088712673 11:112522824-112522846 TTCCAGAAGCAGAATGGAGAAGG + Intergenic
1089004013 11:115075577-115075599 GGGAAGAAGCTGAGTGGAGAGGG + Intergenic
1089454027 11:118615413-118615435 GGGCAGAAGCTGAAAGGTGAAGG - Intronic
1089461799 11:118658236-118658258 GTGCAGAGGTTTAATGGGGCAGG + Exonic
1089613583 11:119683027-119683049 CTGCAGGAGATGAAAGGAGCAGG + Intronic
1092010330 12:5104875-5104897 ATGCAGCTTCTGAATGGAGCTGG - Intergenic
1092015584 12:5155921-5155943 GGCCAGAAGCTCAATGCAGCAGG + Intergenic
1092254698 12:6920110-6920132 TTGTGGATGCTGAATGGAGCTGG + Intronic
1094487895 12:30939332-30939354 GTGCTGAAGCTGCAGGGGGCTGG + Intronic
1096113418 12:49041641-49041663 GTGCAGAAGGTGAGTGGGGCTGG - Exonic
1099842230 12:87980730-87980752 GGGCAGAAGCTGAAGGCAACTGG - Intronic
1099943197 12:89214574-89214596 AAGCAGAAGTTAAATGGAGCGGG + Intergenic
1100455040 12:94743357-94743379 GTACAGAATCTGAATGAATCTGG + Intergenic
1101212537 12:102548879-102548901 GAGCAGGAGCTGCATGGAGATGG + Intergenic
1101831456 12:108260684-108260706 GTTCAGTAGCTGATTTGAGCAGG + Intergenic
1104349080 12:128029284-128029306 GAGGAGCAGCAGAATGGAGCAGG - Intergenic
1107789769 13:43990044-43990066 GGGCAGCATCTGGATGGAGCCGG - Intergenic
1110208657 13:72947329-72947351 GTCCCGAAGCTGCATAGAGCAGG + Intronic
1110461879 13:75754190-75754212 TGCCAGAAGCTGAATGGAGGAGG - Intronic
1112577540 13:100649288-100649310 GGGCAGAAGTTTGATGGAGCAGG - Intronic
1113937725 13:114003248-114003270 GTGCAGCTGCTGGAAGGAGCTGG + Intronic
1114583493 14:23787392-23787414 TTGCAGAAACAGAATGGAGCTGG - Intergenic
1116088005 14:40266285-40266307 GTGCAGAAGCTGAGGGGATGTGG + Intergenic
1117314860 14:54565119-54565141 GCGCAGAGGCTGAGTGGCGCAGG - Intergenic
1117833845 14:59781215-59781237 GTGAACAAGCAGAAGGGAGCTGG - Intronic
1119800544 14:77441096-77441118 GGGAAGAAGCAGAAGGGAGCAGG + Intronic
1121580686 14:95027343-95027365 GTGCTGAAGCTCAGTGGGGCAGG - Intergenic
1122488605 14:102097891-102097913 GGGCAGAAGCTGACAGGACCAGG - Intronic
1122820535 14:104342609-104342631 CTGCAGAGGCTGAGGGGAGCAGG + Intergenic
1125186876 15:36941033-36941055 CTGCAGAAGAAGAATGGAGGGGG - Intronic
1125515332 15:40316034-40316056 ATCCAGAAGCTGAATAGAGCTGG - Intergenic
1126302839 15:47219211-47219233 GTAAAGAAGCTGGATGGAGTTGG + Intronic
1128563055 15:68681328-68681350 GTGCAGAAGCCCAGAGGAGCAGG + Intronic
1129538450 15:76332889-76332911 GGGCAGAAGGAGAATGGAGGGGG + Intergenic
1129710332 15:77817499-77817521 GTGCAGAGGATGACAGGAGCCGG + Intronic
1132271816 15:100533022-100533044 GTGTGGAAGCGGAGTGGAGCGGG - Intronic
1137632762 16:49958696-49958718 TTCCAGAGGCTGAATGAAGCAGG + Intergenic
1138530366 16:57631351-57631373 GTGCAGAAGCTGTGTGCAGGTGG + Intronic
1139259702 16:65579727-65579749 GTGCTGCTGCTGAGTGGAGCAGG + Intergenic
1139966200 16:70746748-70746770 GTGCAGGGGCTGAATCGGGCAGG - Intronic
1141832306 16:86516640-86516662 GGGCAGGAGCTGCTTGGAGCAGG + Intergenic
1141832308 16:86516656-86516678 GAGCAGGAGCTGCTTGGAGCAGG + Intergenic
1141835835 16:86538684-86538706 GATCAGAAGATCAATGGAGCTGG + Intronic
1142252948 16:89001112-89001134 GGGCAGAAGCTGGATGGAGGCGG - Intergenic
1142772828 17:2111869-2111891 TTCCAGAAACTGCATGGAGCGGG - Intronic
1144183368 17:12773070-12773092 GGGCAGAAGATGAATGAAGTGGG + Intergenic
1144816870 17:18040608-18040630 GTGGAGAAGCTGGAAGGAGCTGG - Intronic
1145263428 17:21367979-21368001 TTGCAGAAGCTCCAGGGAGCCGG - Intergenic
1146552046 17:33789094-33789116 TGGCAGAAGCTGAACGGGGCAGG - Intronic
1146561080 17:33871201-33871223 GTTCAGAAGCTGAATGAGGCTGG + Intronic
1149647871 17:58253519-58253541 GTGCACAGGCTGAATGGAATGGG - Intronic
1152147091 17:78574879-78574901 GTGCTGACGCTCAATGCAGCCGG - Exonic
1152184564 17:78846336-78846358 GTGGGGAAACTGAAGGGAGCCGG - Intergenic
1153496022 18:5700441-5700463 CTGAAGAAGCTGAAAGGAGATGG + Intergenic
1155317379 18:24586086-24586108 GAACAGAAACTGAATGGAGGAGG + Intergenic
1161286121 19:3469285-3469307 GGGCAGAGGCTGCAGGGAGCTGG + Intergenic
1161601901 19:5189212-5189234 GTGCAGAAGATGAACGTAGATGG - Intronic
1163369893 19:16896227-16896249 GACGTGAAGCTGAATGGAGCCGG - Exonic
1163643668 19:18476184-18476206 GTGCAGCAGCTGCAGAGAGCAGG + Intronic
1165309335 19:35021172-35021194 GTGCAGCAGCCGAATGGAAGAGG + Intronic
1165860167 19:38905244-38905266 GTGGAGAAGCTGTACGCAGCAGG + Exonic
1167567718 19:50267274-50267296 CTGCAGAGCCAGAATGGAGCTGG + Intronic
925458814 2:4042547-4042569 GAGAAGAGGCTGAATGGAGGTGG - Intergenic
926742786 2:16126152-16126174 GGGCAGAAGCTGCGTGGAGAGGG - Intergenic
928221441 2:29406551-29406573 TTGCAGAGCCTGCATGGAGCTGG + Intronic
928414187 2:31078131-31078153 GTGCAGGTTCTGAAAGGAGCAGG + Intronic
928443932 2:31316374-31316396 GTGCAGACACTCAAGGGAGCAGG - Intergenic
929080745 2:38119744-38119766 GGGCAGAAGCTAAAAGGAGGTGG + Intergenic
930551190 2:52836662-52836684 ATCCAGAAGCAGAAAGGAGCAGG + Intergenic
930864572 2:56109796-56109818 GGGAAGAATCTGAATGGAGCAGG - Intergenic
932365572 2:71150881-71150903 CTGCAGAAGCTGGCTGCAGCAGG + Intergenic
932647462 2:73518262-73518284 TTGCAGAACATGGATGGAGCTGG - Intronic
937084950 2:119165423-119165445 GTGCATAAACAAAATGGAGCTGG - Intergenic
938113073 2:128581982-128582004 GTGCAGAGGCTGCCTGGAGCAGG + Intergenic
938139638 2:128784987-128785009 GAGCTGCTGCTGAATGGAGCGGG + Intergenic
939200842 2:139031760-139031782 GTGCAGCAGCTGACTGGGGGAGG + Intergenic
940783655 2:157959391-157959413 GTCCAGAGGCTGCATAGAGCAGG + Intronic
942091030 2:172491536-172491558 GTTCTGAACCTGAATGAAGCTGG - Intronic
943041938 2:182814384-182814406 GTGCAGAGTCTGAAGGCAGCTGG + Intergenic
945377471 2:209096298-209096320 TTGCAGAACATGGATGGAGCTGG - Intergenic
946310968 2:218882450-218882472 GTGGAGATGCTGGATGGGGCAGG - Intronic
946358192 2:219202130-219202152 ATGCGGAAGCTGATTGAAGCTGG - Intronic
947931868 2:233971508-233971530 GTGCAGATGGGGAATGGAGCTGG + Intronic
948458524 2:238118324-238118346 GTGGAGAAGGTGGATGGAGGAGG + Intronic
1171406565 20:24915771-24915793 CTGCAGAATCTGCAGGGAGCTGG - Intergenic
1171814000 20:29767287-29767309 CTGTAGAAGCTGAATGGATAAGG - Intergenic
1172409534 20:34711040-34711062 GTTGAGAAGCTGCAGGGAGCAGG + Exonic
1172981003 20:38941642-38941664 GAATAGAAGGTGAATGGAGCAGG + Intronic
1173248270 20:41350767-41350789 GTCCAGAAACTGAAAGCAGCTGG + Intronic
1173466455 20:43285961-43285983 GTGGAAAAGCTGTATGGAGCAGG - Intergenic
1173666359 20:44766140-44766162 GGGCAGAAGTGGAATGGAACGGG - Intronic
1173929687 20:46808104-46808126 GCCCAGAAACTGAGTGGAGCTGG + Intergenic
1174369214 20:50075039-50075061 ATGCAGAAGCTGCAGTGAGCTGG + Intergenic
1174369389 20:50076332-50076354 ATGCAGAAGCTGCAGTGAGCTGG - Intergenic
1174406182 20:50304806-50304828 TCGCTGCAGCTGAATGGAGCAGG - Intergenic
1178946210 21:36949950-36949972 GTGCAGATGGGGAATGTAGCAGG - Intronic
1179896501 21:44366364-44366386 GTGCAGGAGCTGATTAGACCCGG + Intronic
1180074991 21:45457668-45457690 AAGCAGAATCTGAATGGGGCAGG - Intronic
1180317452 22:11287890-11287912 CTGCAGATGCTGAATGGATAAGG - Intergenic
1180843072 22:18968231-18968253 GTGCAGAGGCAGAGTTGAGCAGG - Intergenic
1180935976 22:19625603-19625625 GTGCAGAGGCTGTGTGCAGCAGG - Intergenic
1181058400 22:20270501-20270523 GTGCAGAGGCAGAGTTGAGCAGG + Intronic
1182107467 22:27699574-27699596 GTGGAGAAGGTGCATGGAGTGGG - Intergenic
1184809758 22:46823383-46823405 GAACAGAAACTGAATGGAGCTGG - Intronic
952141134 3:30480334-30480356 GTCCTGAGGCTGCATGGAGCAGG - Intergenic
952465845 3:33584819-33584841 GTGCTGAGGCTGAATTGACCAGG + Exonic
954330043 3:49884966-49884988 CTGCAGAAGCTCAATGGGGAAGG + Intergenic
954458995 3:50615820-50615842 GTGCAGATGTTGAGTGGAGATGG - Intronic
955183625 3:56693965-56693987 GTGCAGTAGCTTACTGGAACTGG - Intergenic
956158301 3:66321388-66321410 GTGCAGGAGGTGACTGGGGCAGG - Intronic
956171590 3:66437691-66437713 TTGCAGCAGCTGCATGTAGCAGG - Intronic
956339986 3:68211715-68211737 TGGCAGAAGGTGAAGGGAGCTGG + Intronic
957014487 3:75047124-75047146 GTGAAGAATGGGAATGGAGCAGG + Intergenic
961101280 3:124201341-124201363 GTGGAGATGCTGCATGGTGCAGG + Intronic
962509456 3:136084207-136084229 GTTCAGAGGCTGCATAGAGCAGG - Intronic
963093665 3:141511648-141511670 GGTCAGAAGCTGATTGGAGAGGG + Intronic
964090888 3:152874277-152874299 GTTCAGAGGCTGCATAGAGCAGG + Intergenic
964285101 3:155109305-155109327 GTGCTGAAGCTGGATGATGCAGG - Intronic
964881289 3:161426074-161426096 GTGGTGAAGCAGTATGGAGCTGG + Intergenic
968880436 4:3296014-3296036 CTCCAGAAGCTGACTGGGGCGGG - Intronic
971375348 4:26051561-26051583 GTGCAGCAGCTGAGTGGGGCTGG + Intergenic
973804304 4:54510647-54510669 GTGAAGAAGTTCACTGGAGCAGG - Intergenic
976680753 4:87753422-87753444 GTGCAGAAGGGAAATGGAGTTGG - Intergenic
977729148 4:100331099-100331121 GGAAAGAGGCTGAATGGAGCGGG + Intergenic
978042771 4:104090700-104090722 GTGCAGAAGCTGCAAGGACAGGG + Intergenic
978430358 4:108626813-108626835 ATGCAGAAGCTGAAAGTACCTGG + Intronic
978760793 4:112355389-112355411 GAGCAGAAGCTGGACCGAGCGGG + Intronic
979448014 4:120838156-120838178 GTACAGAGGCTGAATGGAAGAGG - Intronic
980283604 4:130754198-130754220 GTACATATGCTGATTGGAGCTGG + Intergenic
984682345 4:182624565-182624587 GTGGAGAACCTGAGGGGAGCTGG - Intronic
984863607 4:184261463-184261485 CTGCAGAAGAGGAAAGGAGCTGG - Intergenic
985677749 5:1241016-1241038 GTGCAGAAGCTGGAAGAGGCGGG + Intronic
985965485 5:3336196-3336218 GGGCAGCAGCTGCACGGAGCGGG + Intergenic
986264743 5:6182066-6182088 GTGCAGAAGGTGACAGAAGCTGG + Intergenic
990511535 5:56493491-56493513 GTGCAGATCCTGAATGGAGTAGG - Intergenic
991636152 5:68707944-68707966 GTGCAGAAGTTTAATGCAGTGGG + Intergenic
991668087 5:69020037-69020059 CTCCAGAGGCTGAATGGATCAGG + Intergenic
993607168 5:90006056-90006078 TTGCAGCAACTGAATGGAACTGG + Intergenic
994096506 5:95852237-95852259 GTGCAGAAGGGGACTGGAGTGGG - Exonic
995271089 5:110220312-110220334 ATGAAGAAGCTGCATGGTGCAGG + Intergenic
995621903 5:114034862-114034884 TTGCAGAACATGGATGGAGCTGG - Intergenic
997334628 5:133098207-133098229 TTGCAGCAACTGGATGGAGCTGG - Intronic
997785987 5:136714450-136714472 TTGCAGAAAATGGATGGAGCTGG - Intergenic
998604718 5:143621954-143621976 TTGCAGAACATGGATGGAGCTGG + Intergenic
1001448864 5:171808660-171808682 TTGCAGAACGTGGATGGAGCTGG + Intergenic
1001523859 5:172414858-172414880 GTGCAGAGGTGCAATGGAGCAGG - Intronic
1002305810 5:178282105-178282127 GAGGAGCAGCTGAACGGAGCAGG - Intronic
1003311326 6:4972052-4972074 GGGCAGGAGCTGGATGGAGAAGG + Intergenic
1003460008 6:6320530-6320552 GTGCAGAAGGTGGACGCAGCGGG + Intronic
1003842639 6:10137958-10137980 GTGCAGAAGATGAACTGTGCTGG - Intronic
1003861239 6:10323742-10323764 ATGCAGCAGCGAAATGGAGCTGG + Intergenic
1005630317 6:27701120-27701142 GTCCAGAGGCTGAAGGGAGAGGG - Intergenic
1006154556 6:32007246-32007268 CTGCAGAGGGTGAAAGGAGCGGG - Intergenic
1006160867 6:32039982-32040004 CTGCAGAGGGTGAAAGGAGCGGG - Intronic
1006729753 6:36228105-36228127 GCACAGAAGCAGAATGTAGCTGG - Intronic
1006810605 6:36818044-36818066 GTGGAGGAGCTGAGTTGAGCTGG - Intronic
1007484395 6:42170852-42170874 GTGGAGAAGCTGACTGAAGCAGG + Intronic
1007855743 6:44854632-44854654 GTGCAGAAGCTGAATGGAGCTGG - Intronic
1007918097 6:45579816-45579838 CTGCAGAAGCAGAGTAGAGCAGG + Intronic
1009384069 6:63068285-63068307 GTGCAGTACCAGCATGGAGCCGG - Intergenic
1011519321 6:88187246-88187268 CTGCAGAGGCTGATTGGATCAGG - Intergenic
1011845031 6:91552496-91552518 GTCCAGAGGCTGCATAGAGCAGG + Intergenic
1012602843 6:101119293-101119315 TGGCAGAAGGTGAAGGGAGCAGG - Intergenic
1013058616 6:106609907-106609929 GTGCAAAAGCAGCAAGGAGCAGG + Intronic
1013151205 6:107448067-107448089 GTCCAGAAGCTGCATACAGCAGG + Intronic
1013364843 6:109429265-109429287 GTGCAGAAGCAGGCTGGAGTAGG - Intronic
1019656925 7:2200877-2200899 GTGCAGGAGCTGGGAGGAGCGGG + Intronic
1020111547 7:5450834-5450856 CTGCAGAATCTGGAAGGAGCAGG - Intronic
1022785815 7:33635487-33635509 GAGCCGCAGCTGCATGGAGCAGG - Intergenic
1024112910 7:46164438-46164460 ATGAAGAAGCTGGAAGGAGCTGG - Intergenic
1024808956 7:53184536-53184558 GAGAAGAATCTGACTGGAGCTGG + Intergenic
1026103935 7:67406185-67406207 GTTCAGCAGGTGAATGCAGCAGG - Intergenic
1029020429 7:97359153-97359175 GTCCAGAAGCTCACTAGAGCAGG - Intergenic
1030519053 7:110574360-110574382 GTGCAGAAGCTCACTGGTGATGG + Intergenic
1030899316 7:115103017-115103039 GTGCAAATGCTGAATGAAGAAGG + Intergenic
1030923611 7:115423135-115423157 GTCCAGAAGTTGAATGAATCTGG + Intergenic
1031665783 7:124480850-124480872 GTGCAGAAGCTGACCCGCGCCGG + Intergenic
1032158777 7:129493633-129493655 GTTCAAATGCTTAATGGAGCTGG + Intergenic
1033645761 7:143302486-143302508 GTTTAGAAGCTGACTGGGGCAGG - Intronic
1035459627 7:159030941-159030963 GGGCAGAGGCTGGAGGGAGCGGG + Intronic
1036124263 8:6048659-6048681 GTGGAGAGGCTGAATGCAGAGGG + Intergenic
1036731667 8:11270931-11270953 GTACAGACGCTGACTGGAGGAGG - Intergenic
1037917771 8:22783045-22783067 GTGCAGCTTCTGCATGGAGCAGG - Intronic
1039095571 8:33881022-33881044 GTGTAGGAGCTGAGTGAAGCCGG - Intergenic
1042354451 8:67811092-67811114 GAGCAGAAACTTAATGGTGCTGG - Intergenic
1043202991 8:77395325-77395347 TTGCAGAATCTGCATGGAGCAGG + Intergenic
1043397203 8:79850098-79850120 GTGCAGACTCTGAAAGGATCTGG - Intergenic
1044725104 8:95188300-95188322 GTGGAGAAGCAGAAGGCAGCAGG + Intergenic
1045472355 8:102523848-102523870 GTGCAGAGGCAGGCTGGAGCTGG - Intergenic
1046918401 8:119701462-119701484 GTGCACAAACTGAATGCCGCTGG + Intergenic
1047975405 8:130125117-130125139 GAGCAGAACCTGAATGAACCTGG - Intronic
1048786450 8:138055669-138055691 TTGTAGAAGCTGAAAGGAGGAGG - Intergenic
1049265502 8:141665869-141665891 ATGGAGAAGCTGAGTGGAGGAGG + Intergenic
1050010941 9:1185345-1185367 CAGCAGATGCTGAATGGACCAGG + Intergenic
1051422889 9:16906008-16906030 TTGCAGAAGCTGGCTGGGGCTGG - Intergenic
1051984274 9:23063842-23063864 GTCCAGAGGCTGCATAGAGCAGG + Intergenic
1052618780 9:30878098-30878120 TTGCAGAACATGGATGGAGCTGG - Intergenic
1055837061 9:80455970-80455992 GTGCAGAAGTTGAATGTGTCAGG + Intergenic
1056572087 9:87825114-87825136 CTGTAGAAGCTGACTGGAGAAGG - Intergenic
1058129064 9:101228780-101228802 GTGCAGAAGTTGAAGGCAACTGG + Intronic
1061509360 9:131051012-131051034 GTGCAGAAGCGGCCTGAAGCGGG - Intronic
1062199188 9:135292395-135292417 CTGCAGAAGCTGTAGGGAACAGG + Intergenic
1186755774 X:12670026-12670048 GTGCAGTAGCTGTTAGGAGCAGG - Intronic
1188089190 X:25941301-25941323 ATGCAGAAGGTGGATGGAGAAGG + Intergenic
1191148528 X:57194880-57194902 TTGCAGCAACTGGATGGAGCTGG - Intergenic
1192948480 X:75990739-75990761 GTGAAAAAGCTGAAGGGGGCAGG + Intergenic
1196486569 X:116217309-116217331 TTGCAGAACATGGATGGAGCTGG + Intergenic
1197061342 X:122184939-122184961 GTACAGAAGCTGCATAGAGTAGG + Intergenic
1198667254 X:139038140-139038162 GGGCAGCAGCTGCATGGAGAAGG - Intronic
1199840523 X:151642846-151642868 CTGCTGCAGCTGAATTGAGCAGG + Intronic