ID: 1007858655

View in Genome Browser
Species Human (GRCh38)
Location 6:44884621-44884643
Sequence ATGTGGATCAGGAGCCAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007858648_1007858655 17 Left 1007858648 6:44884581-44884603 CCAACCCAAATGCCTATCAATGA 0: 114
1: 3247
2: 7960
3: 16966
4: 7488
Right 1007858655 6:44884621-44884643 ATGTGGATCAGGAGCCAAGATGG No data
1007858650_1007858655 12 Left 1007858650 6:44884586-44884608 CCAAATGCCTATCAATGATAGAC 0: 143
1: 3721
2: 8352
3: 17247
4: 6305
Right 1007858655 6:44884621-44884643 ATGTGGATCAGGAGCCAAGATGG No data
1007858652_1007858655 5 Left 1007858652 6:44884593-44884615 CCTATCAATGATAGACTGGATAA 0: 3745
1: 5689
2: 4619
3: 3629
4: 3887
Right 1007858655 6:44884621-44884643 ATGTGGATCAGGAGCCAAGATGG No data
1007858649_1007858655 13 Left 1007858649 6:44884585-44884607 CCCAAATGCCTATCAATGATAGA 0: 171
1: 4466
2: 9868
3: 18507
4: 8929
Right 1007858655 6:44884621-44884643 ATGTGGATCAGGAGCCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007858655 Original CRISPR ATGTGGATCAGGAGCCAAGA TGG Intronic
No off target data available for this crispr