ID: 1007865570

View in Genome Browser
Species Human (GRCh38)
Location 6:44965772-44965794
Sequence GTATTTAAGATGATAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 210}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007865570 Original CRISPR GTATTTAAGATGATAGTGGA AGG (reversed) Intronic
900770253 1:4535713-4535735 TTATTTAATAACATAGTGGAAGG + Intergenic
903980098 1:27179835-27179857 TTTTTTAAGTTTATAGTGGAAGG + Intergenic
904027361 1:27513028-27513050 GTCTGTAAGATGGGAGTGGATGG + Intergenic
907011529 1:50968364-50968386 TTATTTAAGACGGTTGTGGAGGG - Exonic
908766156 1:67556306-67556328 GTATTTAGGCTGAAAGTTGAAGG - Intergenic
909753406 1:79192629-79192651 GTACTTAAGCTGATCCTGGAAGG - Intergenic
909845225 1:80385431-80385453 GAATTTCAGATGAGATTGGACGG - Intergenic
910150535 1:84137790-84137812 GTAAATAAGTTGATGGTGGATGG + Intronic
910781373 1:90938658-90938680 TTATTTAAGAGCAAAGTGGAAGG - Exonic
911222537 1:95264126-95264148 TTATTTAATATGATATGGGATGG - Intergenic
912402653 1:109408216-109408238 GTATATAAGATGGTGGGGGACGG - Intronic
912949780 1:114112704-114112726 TTAATGAAGATGACAGTGGAAGG - Intronic
913114107 1:115680963-115680985 GTATTTAACATGGTGGTGGTTGG + Intronic
913118386 1:115717445-115717467 GTTTTTAAGAGGATCATGGAAGG - Intronic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914506870 1:148296979-148297001 ATATGTAAGAAGAGAGTGGAGGG - Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915671982 1:157497286-157497308 GTTTTTAAGGATATAGTGGAGGG - Intergenic
917688567 1:177444022-177444044 GTATTTAAGTGTATAGAGGATGG - Intergenic
918226835 1:182491509-182491531 GTATAAAAGATGATAGTGGTCGG - Intronic
919257630 1:195143714-195143736 GTATTAAAGATGAGAGTCTACGG - Intergenic
919284468 1:195537403-195537425 GAATTTATGAAGATATTGGAGGG + Intergenic
923640638 1:235756141-235756163 GCATTTAAGATGCTAGAGAAGGG - Intronic
1063229899 10:4054800-4054822 GAATCTCAGATGACAGTGGAGGG + Intergenic
1066109852 10:32186264-32186286 GTATTTCTGTTGATAGTTGATGG + Intergenic
1066498008 10:35961135-35961157 ATATTTAAGATGATTGGGCAAGG + Intergenic
1066625711 10:37403415-37403437 ATATTTAAGATGATTGGGCAAGG + Intergenic
1067519679 10:46988520-46988542 GTATTAAAGATGATAAGGAAAGG - Intronic
1067642569 10:48063319-48063341 GTATTAAAGATGATAAGGAAAGG + Intergenic
1068009604 10:51431523-51431545 GAATTTAAGAAGATAGTTGAAGG + Intronic
1068146339 10:53075785-53075807 GTTTTTAAGAAAATTGTGGAGGG - Intergenic
1068596949 10:58912449-58912471 GTATGTTAAATAATAGTGGAGGG + Intergenic
1072701790 10:97647340-97647362 ATATTAAAGAAGAGAGTGGATGG + Intronic
1075036298 10:119071117-119071139 ATATTTAAGTAGATAGTGGAAGG - Intronic
1075154929 10:119967362-119967384 GTTTTTAAGGAGATTGTGGAGGG + Intergenic
1077749895 11:4955312-4955334 GTATCTCAGAGGATTGTGGATGG + Exonic
1078872778 11:15364396-15364418 GTATTTAAGATGAGAGTATTTGG + Intergenic
1079991020 11:27247096-27247118 TTATTTATGAGGATACTGGAAGG + Intergenic
1080020746 11:27557298-27557320 GTCCTTAAAATGATAGTGTAAGG + Intergenic
1081344362 11:41964854-41964876 GTATTTATGATGATATGGCATGG - Intergenic
1082143007 11:48631666-48631688 AAATTTACGATCATAGTGGAAGG + Intergenic
1082803850 11:57434011-57434033 GCATTTATCATGATTGTGGAAGG + Intergenic
1090010284 11:123039991-123040013 GCATTTAAGATGATAAGAGACGG + Intergenic
1093387459 12:18575668-18575690 GCATTTAAGATGATATTAAAGGG + Intronic
1094417294 12:30230871-30230893 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1095671886 12:44871164-44871186 TCATTTAAGCTGATAGTTGAAGG - Intronic
1097699356 12:62804134-62804156 CTATTCAATATGATACTGGAAGG + Intronic
1099504959 12:83462750-83462772 GTGTTTCAGTTGACAGTGGAAGG + Intergenic
1100191617 12:92198972-92198994 GTATTAAATATGATGTTGGATGG - Intergenic
1100543015 12:95575890-95575912 GTCTTTAAGAAGGTACTGGAGGG + Intergenic
1101993742 12:109509684-109509706 GTGTTTAAGATGATCTGGGATGG + Exonic
1104963361 12:132498471-132498493 GTCTGTAGGATGAGAGTGGAGGG - Intronic
1105700232 13:22930242-22930264 GGATGTGAGATGGTAGTGGAAGG - Intergenic
1105853007 13:24352192-24352214 GGATGTGAGATGGTAGTGGAAGG - Intergenic
1106467748 13:30027893-30027915 GTGTTTAAGATGAAATTGGCAGG + Intergenic
1107691016 13:42953032-42953054 ATATTTCATATGAAAGTGGAGGG + Intronic
1108014644 13:46061760-46061782 GTGTTGGAGATGAGAGTGGAGGG - Intronic
1108293339 13:48985529-48985551 GTATCTAATATTATAGTGTAAGG - Intronic
1108322547 13:49302406-49302428 GTATTTAAGCTGAGAGAGCAAGG + Intergenic
1110061091 13:71039129-71039151 GTATTTGAGATGATGGATGATGG - Intergenic
1110164059 13:72416399-72416421 GTAGATAAGATGATGGAGGAAGG - Intergenic
1112416055 13:99204466-99204488 GTCTTTCAGAGGACAGTGGAAGG + Intronic
1114015115 14:18421342-18421364 GGATTCCAGAAGATAGTGGATGG - Intergenic
1114042876 14:18694829-18694851 CTATTTAAGATAATAGTAGTTGG + Intergenic
1115206216 14:30908375-30908397 GTATTAAATTTGATAGTGTAGGG - Intronic
1116643739 14:47499600-47499622 GTATATAAGCTGATAGTGGTAGG - Intronic
1117774932 14:59174040-59174062 GTTTTTAAAATGATAATGAAAGG - Intergenic
1118965043 14:70573662-70573684 GCATTTAAGCTGAAAGTGAAGGG + Intergenic
1119552839 14:75528028-75528050 ATAATTAAGAGGATAATGGATGG - Intronic
1122550896 14:102549204-102549226 GGATTTGAGAGGATAGTGGTGGG + Intergenic
1122839433 14:104448678-104448700 GTGTTAAAGAAGATAGAGGAAGG + Intergenic
1124134240 15:27020061-27020083 TAATTCAAGATGAGAGTGGAGGG - Intronic
1124511667 15:30332523-30332545 GTAATTAAAATGATACTGGAGGG - Intergenic
1124731247 15:32198234-32198256 GTAATTAAAATGATACTGGAGGG + Intergenic
1125105223 15:35962950-35962972 GTATTTAAAATGATCCTGCAAGG - Intergenic
1126718645 15:51551969-51551991 GTATTTAAACTGAGAGTTGAAGG + Intronic
1129463229 15:75710315-75710337 GGATTTGAGCTGATACTGGAAGG - Intronic
1129721657 15:77881086-77881108 GGATTTGAGCTGATACTGGAAGG + Intergenic
1135954171 16:26941912-26941934 ACATTTAAAATTATAGTGGATGG + Intergenic
1137507639 16:49068286-49068308 GTTTTTAAGGGGATGGTGGAGGG + Intergenic
1138983317 16:62296995-62297017 GCACTTAAGAAGACAGTGGAGGG + Intergenic
1140793725 16:78415822-78415844 GTAGTTAAGGTGGTAGTGGTGGG - Intronic
1140866163 16:79064294-79064316 GAATTTAAGATGATGGTTTAGGG + Intronic
1142965610 17:3579204-3579226 TTATTTAACATGATTGTGAAAGG - Intronic
1146526153 17:33568540-33568562 ATACTTAAGATGATTCTGGAAGG - Intronic
1146990387 17:37265550-37265572 ATATTTATGATGATATTGGGAGG + Intronic
1147038126 17:37697039-37697061 ATTTTAAAGATGGTAGTGGAAGG + Intronic
1147485077 17:40805063-40805085 GTAGTTAAGATAGAAGTGGATGG + Intergenic
1151339949 17:73464764-73464786 TTATTTGATATGATGGTGGAGGG - Intronic
1153429299 18:4998607-4998629 CTATTTATGATAATACTGGATGG + Intergenic
1155573547 18:27220947-27220969 GGATGTCAGATGATAGTGGAAGG + Intergenic
1157726179 18:49965842-49965864 GTATTTGAGCTCATAGTGAATGG + Intronic
1157885544 18:51362751-51362773 GTATTTATGGAGATAGTAGAAGG - Intergenic
1158684011 18:59596451-59596473 GTATTTAAGATGAAAGAATATGG + Intronic
1159871774 18:73766747-73766769 GTATTTAGGATCAAAGTGGGAGG + Intergenic
1160395753 18:78571495-78571517 GTATTGATGATGAGAGTTGACGG + Intergenic
1160478441 18:79216052-79216074 GCATTTATGATGATATTTGAGGG + Intronic
1163486696 19:17591844-17591866 GTGTTTCAGGTGACAGTGGAAGG + Intergenic
1163616050 19:18329155-18329177 GCATTCATGATGATAGGGGAGGG - Intergenic
1165967903 19:39599515-39599537 CTATTTAACATAATATTGGAAGG + Intergenic
926156751 2:10459457-10459479 ATATTTAAAATGCTATTGGATGG + Intergenic
928337339 2:30408919-30408941 GTATTTAAGATGAAAGGAGAAGG - Intergenic
928737333 2:34307445-34307467 GTACTTGAAATGATAGTGAAAGG - Intergenic
930660158 2:54045246-54045268 GTTTTTAAGGGGATCGTGGAGGG - Intronic
932850231 2:75177412-75177434 TGATTTAACATGAAAGTGGAAGG - Intronic
933236345 2:79869026-79869048 GAAGTTAAGATCATTGTGGAGGG + Intronic
935629309 2:105199624-105199646 GAATTCAAGATGAGAGTGGGTGG - Intergenic
939702746 2:145414011-145414033 GCATTTAAAATGAGAGTGCAAGG + Intergenic
939731893 2:145795056-145795078 ATATTTCAGAGGAGAGTGGATGG - Intergenic
940158176 2:150681404-150681426 GTTTTTAAGAGGATCATGGAGGG + Intergenic
941233721 2:162943295-162943317 GTATTTAACCTGAGGGTGGAGGG - Intergenic
941670217 2:168284851-168284873 GTTTTGAAAATGATATTGGAAGG + Intergenic
944389957 2:199207615-199207637 GGAGTTTACATGATAGTGGAGGG - Intergenic
948033147 2:234836130-234836152 GAATTTAAGATGTTAGAGGCTGG - Intergenic
948282399 2:236757485-236757507 GAATTTTGGATGGTAGTGGAGGG + Intergenic
1169025908 20:2371251-2371273 TTATTTCAGATGATAATGGTGGG - Intergenic
1171166195 20:22974093-22974115 GTTTTTAAGAGGACTGTGGAGGG - Intergenic
1175003037 20:55650755-55650777 GTATTGAAACTGAAAGTGGAGGG - Intergenic
1175469536 20:59217550-59217572 GTATTTAATATGCTACTGGTAGG - Intronic
1177340873 21:19798349-19798371 CTATTTAAGATGAGAGTGAAGGG - Intergenic
1177847004 21:26301309-26301331 GAATTTAAGATGAGATTGGGTGG - Intergenic
1180439616 22:15352119-15352141 GGATTCCAGAAGATAGTGGATGG - Intergenic
1180723096 22:17923943-17923965 GAACTTATGATCATAGTGGAAGG + Intronic
1185257175 22:49841150-49841172 GTTTTTAAAATCATATTGGATGG - Intergenic
949143293 3:662865-662887 GAACTTAGGATAATAGTGGATGG + Intergenic
950279534 3:11694734-11694756 GTTTGCAAGATGAAAGTGGAGGG + Intronic
951880044 3:27472026-27472048 GAATTTCAGATGATGGGGGATGG - Intronic
955365801 3:58308865-58308887 GTATTTAAACTGAAAGTTGAAGG + Intronic
955674188 3:61433382-61433404 GTTTTTAAGGTGATAGAGCAAGG + Intergenic
956337316 3:68178372-68178394 TTATTTAATATTGTAGTGGAAGG + Intronic
957683573 3:83471104-83471126 TTATTTAAAATTATAGTGGAAGG - Intergenic
958741626 3:98080425-98080447 GTATTTAACATTATACTGGCAGG - Intergenic
959033129 3:101326412-101326434 GTCTTTAATATGAGAGAGGAAGG - Intronic
959963363 3:112326993-112327015 GTAGTTAAGATGAGAGTTGATGG + Intergenic
962240860 3:133749697-133749719 TTATTTAAGTTGCTAGTGGGAGG + Intronic
963457788 3:145567975-145567997 GCATTTGAGATGACAGTTGATGG + Intergenic
964679756 3:159324930-159324952 CTATTTAAGATTATACTGTATGG - Intronic
969883905 4:10198320-10198342 GTATGTATGTTCATAGTGGAAGG - Intergenic
970830828 4:20337503-20337525 GAATTTAAGATGAGATTTGATGG + Intronic
972567173 4:40280191-40280213 GTCATTGAGATGATAGTGGTTGG + Intergenic
976945434 4:90760984-90761006 GTATTTAAGCTGAGACTTGAAGG + Intronic
977286566 4:95114968-95114990 GTATGTATGATGACAGTGGATGG + Intronic
978354968 4:107862332-107862354 GTATTTATGACGGTATTGGAGGG + Intronic
978810454 4:112843531-112843553 GTATTAAAGATGAAGGTGGGTGG - Intronic
981464579 4:145053570-145053592 GTATTTGAAATTATAGTTGATGG - Intronic
983874975 4:172864855-172864877 GTATTTAAAATTATTTTGGAAGG + Intronic
986514763 5:8549623-8549645 GTTTTTAATCTGATAATGGAGGG + Intergenic
986566968 5:9124907-9124929 GTCTTTCCGATGGTAGTGGATGG - Intronic
986792612 5:11177952-11177974 GTATATAAGATGATACTTGTTGG + Intronic
987373431 5:17213793-17213815 GTATTACAGATGAAAGTGTACGG - Intronic
987718265 5:21599920-21599942 GTAATTAAAATGATTATGGAAGG - Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
990396431 5:55384891-55384913 GTTTTAAAAATGATAGTGGGAGG - Intronic
992354301 5:75965036-75965058 ATATTTAAGATGATAGTATTAGG + Intergenic
993829202 5:92732493-92732515 GTATTTATCATGAGAGTGAATGG + Intergenic
994740870 5:103617102-103617124 GTATTTAATATGAAATTAGAAGG + Intergenic
994987188 5:106951598-106951620 GTATTTAAGAAAATAGTGAGAGG - Intergenic
996276185 5:121668725-121668747 GTTTTTAAGGGGATCGTGGAGGG + Intergenic
996484212 5:124012404-124012426 GTGTTTCAGAGAATAGTGGATGG + Intergenic
997896897 5:137727006-137727028 GTAATTTAGAGGATAGAGGAGGG - Intronic
998365760 5:141629792-141629814 GTGTTTAGGATGATGGTGGGGGG - Intronic
999673789 5:153979312-153979334 GGAGTTGAGATGATATTGGATGG - Intergenic
1000083288 5:157867523-157867545 ACATTTAAGATGAGAGTGTAAGG + Intergenic
1000435695 5:161205412-161205434 GTTTTTAAGATGAAAGGGGGCGG - Intergenic
1000726767 5:164781556-164781578 GTTTTTAACATGAAAGTGGTTGG + Intergenic
1001370315 5:171193422-171193444 GTATTTCAGATGAAAATGGGGGG + Intronic
1005005590 6:21284120-21284142 GGATTAAAAATGATATTGGAAGG + Intergenic
1005195214 6:23274655-23274677 GTATTTAATATCATATTGAATGG - Intergenic
1007261204 6:40564576-40564598 GTAATTTAGATTATAGTGGTGGG - Intronic
1007795161 6:44341212-44341234 AAATTTAAGATTATAGTTGATGG - Intronic
1007865570 6:44965772-44965794 GTATTTAAGATGATAGTGGAAGG - Intronic
1009469452 6:64014220-64014242 GTAATTCAGATGATATTGGTAGG + Intronic
1009595705 6:65732841-65732863 GTATTTAAGAAGGTATTAGAGGG - Intergenic
1010857231 6:80854896-80854918 GTATTTGATATCATAGTAGAAGG + Intergenic
1012396185 6:98800346-98800368 CTATTTAAGTTGATACTTGAAGG - Intergenic
1013653012 6:112215219-112215241 TTATTTAAGAAGATGGGGGAAGG + Intronic
1014269636 6:119322157-119322179 GTGCTCAAGATGATTGTGGAAGG - Intronic
1014365927 6:120541887-120541909 GCATTTAAGGTGATACTGGAAGG + Intergenic
1014710617 6:124802355-124802377 GTCTTTCAGATGAAATTGGAAGG - Intronic
1016127995 6:140429896-140429918 ATATTTAACATTATACTGGAAGG - Intergenic
1016350380 6:143160505-143160527 GTACTTAAACTGAGAGTGGAAGG - Intronic
1017650237 6:156574366-156574388 GTGTTCAAGATGATATTGGTGGG - Intergenic
1018102481 6:160453572-160453594 CTATTTAGGGTGACAGTGGAGGG - Intergenic
1018220574 6:161574122-161574144 ATATTTAAGAAGACCGTGGACGG + Intronic
1021117651 7:16761925-16761947 GAAGTTATGATGGTAGTGGAAGG - Intronic
1021217009 7:17928656-17928678 GATTTTAAGATGTTAGTGGCGGG - Intronic
1024902501 7:54336465-54336487 GTATTTAGGATGAGACTGGAAGG - Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027984666 7:85272166-85272188 GGATCTAAGAAGATAGGGGATGG - Intergenic
1028366356 7:90037146-90037168 GTACTTAAGATGAAAATAGAAGG + Intergenic
1028755723 7:94431821-94431843 GTATTAAAGATGTTATTGAAAGG - Intergenic
1028914622 7:96244332-96244354 TTATTTAATATGTTAGTTGATGG + Intronic
1030187390 7:106777349-106777371 GAATTTAAGATGGGAGTGGAAGG + Intergenic
1030744738 7:113151501-113151523 GCATTTAAGATCTTTGTGGAAGG + Intergenic
1031173675 7:118322176-118322198 ATCTTTAAGAGGATTGTGGAAGG + Intergenic
1032474771 7:132204234-132204256 GGCTTGAAGATGATGGTGGAGGG + Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034846219 7:154448041-154448063 CTATTTAACATTATATTGGAGGG + Intronic
1037295469 8:17395899-17395921 GTATTTAAAAGTATACTGGATGG - Intronic
1039998783 8:42559228-42559250 ATGTTTAAGATGATAGAGGAGGG - Intergenic
1040391225 8:46952292-46952314 GTATGACAGATGATAGTTGATGG - Intergenic
1042877656 8:73454619-73454641 GTGTTGAAGAAGAGAGTGGATGG - Intronic
1043194179 8:77269369-77269391 GCATTTAAATTGAGAGTGGAGGG - Intergenic
1046289519 8:112138512-112138534 ATATTATAGATGATAGTGCATGG + Intergenic
1047812102 8:128422100-128422122 GCATTTAAACTGATGGTGGAAGG + Intergenic
1050305518 9:4301664-4301686 GTATTTAAAATGATATTTGAGGG - Intronic
1051327046 9:15983171-15983193 GTATTTAAGAGGAAAGGGGAAGG - Intronic
1052426922 9:28316742-28316764 GTATATAAGATTATAGAAGAGGG + Intronic
1052512447 9:29439047-29439069 GTATATAAAATGATAATGTAGGG - Intergenic
1055216182 9:73865520-73865542 GTATTTTAGATGATACAGGCTGG - Intergenic
1056349756 9:85738303-85738325 GTATGTAAAATCATACTGGAGGG + Intronic
1056579287 9:87878724-87878746 GTTTTTAAGGAGATTGTGGAGGG - Intergenic
1059025913 9:110629698-110629720 ATATTCAAGAAGATAGAGGAAGG - Intergenic
1059128012 9:111712399-111712421 GTTTTGAAAATGATAATGGAAGG + Intronic
1060637235 9:125208989-125209011 GTATTTTAGATGATATTCGCTGG - Intronic
1061998701 9:134204837-134204859 GTATTTAAGCTGAAACTGGAAGG - Intergenic
1188145795 X:26611696-26611718 CTATTGAAGTTGAGAGTGGAAGG + Intergenic
1189905298 X:45753196-45753218 GTATTTGTGCTGACAGTGGAAGG + Intergenic
1189933674 X:46041741-46041763 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1192488876 X:71556118-71556140 GCATTTAGCATGATAGTAGAGGG + Intronic
1193137511 X:77988635-77988657 GTGCTGAAGATGAAAGTGGAAGG + Exonic
1195136043 X:101908295-101908317 GTATTAAAGATTTTAATGGATGG - Intronic
1195390587 X:104358071-104358093 GTTTTTAAGCGGATTGTGGAGGG + Intergenic
1196605778 X:117655567-117655589 AAATTTAAAATGATGGTGGAAGG + Intergenic
1197804587 X:130386644-130386666 GTATCCAAGATGAGAGTGGCAGG - Intergenic
1198625647 X:138569982-138570004 GTATTTAAGAAGAAATTAGATGG - Intergenic
1198718826 X:139593031-139593053 GTAACTAACATGATAGTGGTTGG + Intronic
1198969670 X:142267156-142267178 GAGGTTAAGATGATACTGGAAGG + Intergenic
1199619102 X:149683400-149683422 GTTTTTAAGAGGATCATGGAGGG + Intergenic