ID: 1007875032

View in Genome Browser
Species Human (GRCh38)
Location 6:45088285-45088307
Sequence CATGACATGCTAAAGCAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 210}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007875032 Original CRISPR CATGACATGCTAAAGCAGAA GGG Intronic
902682733 1:18055112-18055134 GCTGAAATGCTGAAGCAGAATGG - Intergenic
905520224 1:38593288-38593310 CATGACACCCTCAAGCAGCAGGG + Intergenic
909817770 1:80017811-80017833 CATGTCATCCTGTAGCAGAAGGG - Intergenic
911376144 1:97054557-97054579 CATTACATGGGAAAGCAAAAAGG - Intergenic
911883846 1:103272521-103272543 CATCACATGAAAAAGGAGAAAGG - Intergenic
913467869 1:119161056-119161078 CAAGATATGCTTAAGCAAAAAGG - Intergenic
914993816 1:152521920-152521942 GATGAAATGATCAAGCAGAATGG - Intronic
916592231 1:166203531-166203553 TATGACATACTAAGGCAGAAAGG - Intergenic
917757502 1:178117320-178117342 CATAAAATGCTTAAACAGAATGG - Intronic
918570693 1:185988381-185988403 AATGACATGCTAATGAAGTATGG + Intronic
918776894 1:188643653-188643675 TATGACATTCTAAAGCATAGAGG - Intergenic
919087469 1:192937708-192937730 CAGCACATGTTAAAGCATAAAGG + Intergenic
919396619 1:197057800-197057822 CATGAGCTTCCAAAGCAGAACGG + Intronic
919615956 1:199808929-199808951 CATGACATAGTAATACAGAAAGG + Intergenic
920195985 1:204227778-204227800 CCTGACCTGCCCAAGCAGAATGG + Intronic
920453274 1:206076856-206076878 CATGAGATTTTAGAGCAGAAAGG - Intronic
920453747 1:206081386-206081408 CATGAGATTTTAGAGCAGAAAGG + Intronic
921297793 1:213721240-213721262 CATCACATGCTGAAGAAGAAGGG - Intergenic
1062826765 10:575636-575658 CATGACATCCAAGAGCAGAAGGG + Intronic
1064891081 10:20174557-20174579 CATGACATTATACTGCAGAAGGG - Intronic
1066169825 10:32829478-32829500 CATCACATGATAAAGGAAAAAGG - Intronic
1067854904 10:49783751-49783773 GGTGTCCTGCTAAAGCAGAATGG + Intergenic
1068446633 10:57133444-57133466 TAATACATGCCAAAGCAGAAAGG + Intergenic
1070032994 10:72694904-72694926 AATGACATACTAATGGAGAAGGG - Intronic
1070381650 10:75885456-75885478 CATGTCATGCTTAAGCTGAAAGG - Intronic
1070507080 10:77123396-77123418 CAAGACTTGCTAAATCAGAATGG + Intronic
1071959645 10:90797896-90797918 CATGAAATGGTGCAGCAGAAAGG - Intronic
1077798294 11:5513997-5514019 CATAACATGCTCAAACAGAAAGG - Intronic
1078496159 11:11819070-11819092 CATGTCTTGCTAGAACAGAAAGG - Intergenic
1079866047 11:25735517-25735539 CTTGACATGCTAAAACAGAAAGG + Intergenic
1079871463 11:25803387-25803409 CCTAACATGGTAAACCAGAAGGG - Intergenic
1081301645 11:41459637-41459659 CATCAAAGGCAAAAGCAGAAGGG + Intronic
1081996959 11:47371911-47371933 CAGAAAATGCAAAAGCAGAAAGG - Intronic
1084467682 11:69335776-69335798 CATGACTTGCCAAAGCTGATTGG + Intronic
1085021130 11:73209031-73209053 CATGTCATGCTACAGCAGGAAGG + Intergenic
1085573897 11:77585379-77585401 CATGACATCTTGAAGCAGGAAGG - Intronic
1086148454 11:83581223-83581245 AATGACAAGCTTAAGCAAAATGG - Intronic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1087183736 11:95163332-95163354 CGTGACTTGCTGAATCAGAATGG - Intergenic
1087680560 11:101214562-101214584 AATGACATGCCAAATCAAAATGG - Intergenic
1090101156 11:123798083-123798105 CAGGACATCTTGAAGCAGAAGGG + Intergenic
1091957618 12:4660652-4660674 CAGGACATGATAAGGCGGAAGGG + Intronic
1092056640 12:5513126-5513148 CATAGCATGCTGGAGCAGAAGGG + Intronic
1092302671 12:7267093-7267115 CATGACATCTTAAAGAAGATGGG + Intergenic
1093133482 12:15420267-15420289 CATGACATGCTAAGGAATTAGGG - Intronic
1095411831 12:41932970-41932992 CCTGCCATCCTAAAGCACAAAGG - Intergenic
1096028624 12:48390652-48390674 CAGGAGATGCTCAAGGAGAATGG - Intergenic
1097727973 12:63095989-63096011 TAAGACATGTTAAAGTAGAATGG - Intergenic
1098241190 12:68468678-68468700 CATGAAATGCTAGACCACAAGGG - Intergenic
1099490406 12:83282113-83282135 CGTCACATGATAAAGGAGAAAGG + Intergenic
1099565196 12:84233797-84233819 CAAGAGATGCTTAAGGAGAAAGG - Intergenic
1099700608 12:86077403-86077425 CATTACATGATAAAAAAGAAAGG + Intronic
1100155631 12:91796850-91796872 CACAAAATGTTAAAGCAGAATGG - Intergenic
1100448045 12:94679082-94679104 CATAACCTGCAAAAGCACAAAGG - Intergenic
1101645023 12:106623626-106623648 CTTAACATGCTAAAGCAGAGTGG - Intronic
1103098166 12:118148643-118148665 TCTGATAGGCTAAAGCAGAAAGG - Intergenic
1107000074 13:35533677-35533699 CATAAAATTCTAAACCAGAAGGG + Intronic
1107317850 13:39152889-39152911 CATCACATGCTATTACAGAAAGG + Intergenic
1108302791 13:49096437-49096459 GATTACATGATAAAGCAAAAGGG - Intronic
1111333068 13:86786356-86786378 CATGAGATGTTACAGCAAAAAGG - Intergenic
1111483393 13:88862434-88862456 AATGCCATGTTACAGCAGAATGG - Intergenic
1112153740 13:96794035-96794057 TGTGACATGCTAAGGAAGAATGG + Intronic
1112625637 13:101100452-101100474 TATCACATGCTTAAGCAAAAAGG + Intronic
1113466274 13:110515419-110515441 CATGACATGCTAGACAAGGAAGG + Intergenic
1113970568 13:114185473-114185495 CCTGACATGCCAACTCAGAAGGG - Intergenic
1119558440 14:75571004-75571026 CATGGCATGACAAAGCAGAGGGG - Intergenic
1120678003 14:87444088-87444110 CATGAAAAGCTGAAGCAGACTGG + Intergenic
1121012348 14:90527881-90527903 CATCACAAGCTAAAGGAAAATGG + Exonic
1121080005 14:91100119-91100141 CATCAAATGTTAAAGCTGAAAGG - Intronic
1121946068 14:98123179-98123201 AAAGACATGCTACAGCTGAAGGG + Intergenic
1125252596 15:37722949-37722971 CATGGCATGCTACAGAAAAATGG - Intergenic
1129661531 15:77555597-77555619 CATGACATTCTTCAGCAGACTGG - Intergenic
1130534100 15:84770873-84770895 CATAAGATGTTAAAGCTGAAGGG - Intronic
1133124386 16:3636309-3636331 GATGATATGCTAAAACAGATGGG - Intronic
1137490052 16:48924823-48924845 AATGAGAATCTAAAGCAGAAAGG - Intergenic
1138003621 16:53309026-53309048 CATGACATTTTAAAGCATAAAGG + Intronic
1138619868 16:58202355-58202377 CATGACATACTGAATCAGAAAGG - Intergenic
1138646397 16:58428496-58428518 CATGTGATGCAGAAGCAGAAGGG + Intergenic
1140037972 16:71385408-71385430 CATGACTGGTTAAGGCAGAAGGG + Intronic
1141879475 16:86848230-86848252 GATAACTTGCTAAAGCGGAACGG - Intergenic
1143034814 17:3988643-3988665 CTTTACATGTTAAAGCATAATGG + Intergenic
1145721465 17:27077097-27077119 CATGACATGGTACTGCACAAGGG + Intergenic
1145918048 17:28588267-28588289 CATGGCATGCTGATGGAGAATGG + Intronic
1146577600 17:34008512-34008534 CATGCCATGATTAGGCAGAAAGG + Intronic
1149534466 17:57421747-57421769 CATGGGAGGCTAAAGCAGGAGGG + Intronic
1151237314 17:72730428-72730450 TATGACATGGTAAAGTTGAAAGG - Intronic
1153291025 18:3501579-3501601 CATGATATGCGGTAGCAGAATGG + Intronic
1153759718 18:8318696-8318718 CATGACATGCTACTGTAGCAAGG - Intronic
1156875598 18:42006646-42006668 CAGGACATGCTAAAATAAAAAGG - Intronic
1157160550 18:45310272-45310294 CATAACATGCAAAAGCAATATGG - Intronic
1158757277 18:60341052-60341074 CATAACATTCTTAATCAGAAAGG + Intergenic
925749588 2:7075612-7075634 CGTGTCATGACAAAGCAGAAAGG + Intergenic
926154168 2:10442388-10442410 CATAACATCCTAAAGGAGATAGG - Intronic
927132613 2:20073227-20073249 CACCACATGCTCAAGCTGAAAGG + Intergenic
929823757 2:45293885-45293907 AATGACATGATATAGCAGAAAGG + Intergenic
931750087 2:65322655-65322677 CATGACATGGAAAAACAGAGGGG + Intronic
932944919 2:76217372-76217394 CATTACATACTAACACAGAATGG + Intergenic
933160949 2:79024624-79024646 GCTGACATGCTAAAGTATAATGG - Intergenic
935005725 2:99074430-99074452 CATTCCATGAGAAAGCAGAATGG - Intronic
935306612 2:101742855-101742877 ACTGACATGCTTAGGCAGAAAGG - Intronic
935502946 2:103864297-103864319 GATGAAATGCTAAATCAGCAAGG - Intergenic
935667036 2:105521793-105521815 CATGTCATGAGACAGCAGAAAGG - Intergenic
939447823 2:142333205-142333227 CATGACATGTTAATGCAGAAGGG + Intergenic
940173715 2:150855583-150855605 GATGAGATGCTAAAGCAGTTTGG + Intergenic
940192795 2:151060424-151060446 CTTGAGATGCTAAAAAAGAAGGG + Intergenic
941168897 2:162113614-162113636 CATGACAGGCTAATTCTGAATGG + Intergenic
941734098 2:168953902-168953924 CAGGACAAGCCAAAGCAGAGAGG - Intronic
942922075 2:181386886-181386908 CATGACAACTTAATGCAGAAAGG + Intergenic
943101011 2:183486550-183486572 CAGGAGATCCTAAAGCAGAATGG - Intergenic
944019157 2:195079817-195079839 CATGACCTGCAAAATCACAATGG + Intergenic
944853741 2:203746385-203746407 CATAACATTCTATAGCAGAAAGG - Intergenic
945004752 2:205392699-205392721 CATGGCATGCAAAAGTAGATAGG - Intronic
945325280 2:208474661-208474683 CATGTCATGCTAAAGCACATTGG + Intronic
945805355 2:214483813-214483835 CAAGCCATGGTGAAGCAGAAGGG + Intronic
945994118 2:216421587-216421609 CATGAAAAACTAAAGCAAAACGG - Intronic
946166189 2:217865373-217865395 CATGTGATGCAAAGGCAGAAAGG - Intronic
946554551 2:220841172-220841194 TATGAGATGCTAAAGAAGAGGGG + Intergenic
947228349 2:227861110-227861132 AGTGACATTTTAAAGCAGAAAGG - Intergenic
947350302 2:229236500-229236522 CCTGAAATGGTAAAGGAGAAAGG + Intronic
1169172384 20:3475169-3475191 GATGCCATTCTAAATCAGAAAGG - Intronic
1171133198 20:22674075-22674097 TATGACATCCTGAAGCTGAAGGG + Intergenic
1172277694 20:33688968-33688990 CAGGTCCTGCTGAAGCAGAAAGG + Intergenic
1172988906 20:39017363-39017385 CATTACATGCTTGAGAAGAAGGG - Intronic
1173311821 20:41903537-41903559 CATGAGATGCAGAAGCAGATTGG - Intergenic
1174525213 20:51164986-51165008 CATGAAATGCCAACCCAGAAGGG + Intergenic
1175325993 20:58128943-58128965 CGTGACCTGCTAAAGCACAGTGG - Intergenic
1175686771 20:61035849-61035871 TATAACATGCTAAAGCTCAAAGG - Intergenic
1177456232 21:21343610-21343632 CCTGACCTGTTAGAGCAGAAAGG + Intronic
1178946185 21:36949684-36949706 CATGTCATTCTCATGCAGAAGGG - Intronic
1181915519 22:26276748-26276770 CATGAGATGCGAAAGCAGTGGGG + Intronic
1183737966 22:39654336-39654358 CAGGACATGATAAAGCTGCAGGG - Intronic
1184001790 22:41680093-41680115 CATTAGATGCTAAAGCTGATGGG - Intronic
949590470 3:5488998-5489020 CATGGCATTCTAAAACAGCATGG - Intergenic
952161953 3:30702831-30702853 CATGACATGCTATACCAGTCAGG + Intergenic
952512874 3:34074775-34074797 CAGGACATGCTGAAGCTAAAAGG + Intergenic
952685639 3:36144802-36144824 CATGAAATGTGAGAGCAGAAGGG + Intergenic
955980790 3:64525272-64525294 CATAGCATGGTAAAGCATAAGGG - Intronic
960178023 3:114540349-114540371 CATTACATCCATAAGCAGAAAGG + Intronic
960555670 3:119027425-119027447 AATGAGATGCGAAAGCAGACAGG + Intronic
962042762 3:131724360-131724382 CATGGAATGTTAGAGCAGAAAGG - Intronic
963084244 3:141422133-141422155 CATGACACCTGAAAGCAGAATGG + Intronic
963619309 3:147585508-147585530 AATGAAAGGCTAAAGCAGTAGGG + Intergenic
964296879 3:155243028-155243050 CATGAGATGTTTAAGCAAAAGGG + Intergenic
965374665 3:167908431-167908453 CGTCACAGGCTAAAGCAGGAAGG + Intergenic
967525875 3:190492129-190492151 CATAACATGCTAATGATGAAAGG - Intergenic
969154574 4:5199118-5199140 CAGGACATTATAAAGCAGATTGG + Intronic
971100736 4:23464248-23464270 TATCACATGATAAAGGAGAAAGG + Intergenic
971691925 4:29847865-29847887 CATGAGATTCTTAAGCATAATGG + Intergenic
972591296 4:40490099-40490121 CACAACATATTAAAGCAGAAGGG + Intronic
973194893 4:47428280-47428302 AATGAAATGCTAAATCAGAAAGG + Intergenic
974490295 4:62556497-62556519 AATGACATGCTAGAGAAAAATGG - Intergenic
977343229 4:95787067-95787089 GTCTACATGCTAAAGCAGAATGG + Intergenic
977832948 4:101615708-101615730 TGTCACATGATAAAGCAGAAAGG + Intronic
977919922 4:102631778-102631800 CATGTCCTGCTAAAGCTGAGAGG + Intronic
978647169 4:110949001-110949023 AATAAAATGCTAAAGTAGAAAGG - Intergenic
980711599 4:136575989-136576011 CATGACATGCCAAAACTGGATGG - Intergenic
980831906 4:138139980-138140002 TATGTCATTCTAAAGCAGAGAGG + Intergenic
981593514 4:146392142-146392164 CATGACATGCAAAAGAACACAGG + Intronic
981810096 4:148764153-148764175 CATGACAACTTAAAGCAAAAGGG - Intergenic
982774496 4:159427919-159427941 CAGGACATGCAACAGCAGTATGG - Intergenic
983019984 4:162663868-162663890 AATGACATGCTAAAGCAGAGTGG - Intergenic
984395467 4:179192694-179192716 CATCACATGCAAAAGAATAAAGG - Intergenic
984533104 4:180942219-180942241 CACGACATGTTAGAGCTGAATGG - Intergenic
984748632 4:183250108-183250130 CCTGACATGCTAAAACCGAAGGG - Intronic
987805449 5:22759683-22759705 CATGACAGTCTTAATCAGAAGGG - Intronic
988915679 5:35891606-35891628 TATGACATGCTGAAAAAGAAAGG + Intergenic
989457363 5:41659628-41659650 TATCACATGATAAAGGAGAAAGG + Intergenic
989512214 5:42301172-42301194 CATTACATGTATAAGCAGAAGGG + Intergenic
990303794 5:54475222-54475244 AATGAGATGCTACAACAGAATGG - Intergenic
994843897 5:104960318-104960340 CATGAGATGATACAGCACAAAGG + Intergenic
994924893 5:106102171-106102193 CATTACATGGTGAAGCAAAAGGG + Intergenic
994967260 5:106690307-106690329 CATGACATGCTACAGAGAAATGG + Intergenic
995452367 5:112316192-112316214 CATGACATTACAAACCAGAAAGG + Intronic
997190049 5:131923600-131923622 AATGAAGTGCAAAAGCAGAATGG - Intronic
1000417293 5:160996335-160996357 TGTCACATGGTAAAGCAGAAAGG - Intergenic
1001591913 5:172871405-172871427 CATGACATGCAAATGGAGATCGG - Intronic
1001747586 5:174103639-174103661 AATCACATGTTAAATCAGAAAGG + Intronic
1002998260 6:2306900-2306922 CATCACATGATAAAGGAGAAAGG - Intergenic
1003340902 6:5219895-5219917 CATGAAAAACTAACGCAGAAAGG + Intronic
1006001827 6:30971199-30971221 CATCACATAATAAAGGAGAAAGG - Intergenic
1007875032 6:45088285-45088307 CATGACATGCTAAAGCAGAAGGG + Intronic
1009400655 6:63251463-63251485 CATGAGATGATACAGCAGAAAGG + Intergenic
1010036562 6:71331884-71331906 CATGTTATGCCAAGGCAGAAAGG - Intergenic
1010111781 6:72244936-72244958 CATGACATATTAAAGCAGACTGG - Intronic
1011347464 6:86387791-86387813 TATTTCATTCTAAAGCAGAATGG - Intergenic
1012545558 6:100415095-100415117 GATGACATGATAAAACAGGATGG + Intronic
1012925601 6:105263968-105263990 CATGAAATGCTAAAACTGACTGG - Intergenic
1013263286 6:108468577-108468599 CATGACTTTCTAAAGCTGACAGG - Intronic
1013406034 6:109844728-109844750 CATTACATTCTAAATCACAAAGG + Intergenic
1014414976 6:121172763-121172785 CGTCACATGATAAAGGAGAAAGG - Intronic
1015715317 6:136186318-136186340 CTTGGGAGGCTAAAGCAGAAGGG + Intronic
1016069232 6:139718591-139718613 CATGAGTTGCAAAAGAAGAAAGG - Intergenic
1017509396 6:155100350-155100372 TATGAAATGCTAACGGAGAATGG + Intronic
1017885598 6:158597087-158597109 CATGACAGGCTCAGGCAGGAAGG - Intronic
1018356927 6:163027751-163027773 CAAGAGATGATAAAACAGAATGG + Intronic
1019049014 6:169169232-169169254 CATGACATGAAACTGCAGAATGG - Intergenic
1019831014 7:3330576-3330598 CATGTCATGATACAGCAGGAAGG + Intronic
1021051365 7:15989413-15989435 TATGACATTCTAAAACAGCAGGG - Intergenic
1021056172 7:16049030-16049052 CATGTCATTCAAAGGCAGAAGGG + Intergenic
1021673649 7:23058761-23058783 CATTTCATCCCAAAGCAGAATGG + Intergenic
1022253567 7:28632588-28632610 CATGTAATGCTAAGGCAGGAAGG + Intronic
1023113235 7:36835238-36835260 CATGACATTATAAAGAAGGAAGG - Intergenic
1024779117 7:52825905-52825927 CAGGACTTGTAAAAGCAGAAAGG + Intergenic
1027406779 7:77870902-77870924 TATCACATGATAAAGGAGAAAGG + Intronic
1028104272 7:86858531-86858553 CATGTCATGATACAGCAGGAAGG + Intronic
1028290952 7:89064646-89064668 CATGACATGCCCCACCAGAAGGG - Intronic
1030708622 7:112722434-112722456 CATGAAATGCTAAACTGGAATGG + Intergenic
1034410609 7:150939622-150939644 CATCACCTGGTAGAGCAGAAAGG + Intergenic
1034445770 7:151113529-151113551 CATGGAATTCTAAAGCTGAAAGG + Intronic
1034575343 7:151992239-151992261 CATGAAAGTCAAAAGCAGAAAGG - Intronic
1035117496 7:156536908-156536930 CATGACATTTTAAAAAAGAAAGG - Intergenic
1035117774 7:156539069-156539091 CATGACATTTTAAAAAAGAAAGG - Intergenic
1037148934 8:15611488-15611510 CATTACATTCAAAAGCAAAAAGG - Intronic
1043637653 8:82406345-82406367 CATGACAAGCTAGAACAGCAGGG - Intergenic
1045668251 8:104514859-104514881 CATGATATGCCAAATCAGACTGG + Intronic
1045716435 8:105052116-105052138 CATGACATATTAAAGCTGAAAGG + Intronic
1046406018 8:113773690-113773712 CATTACTTGCTGAAGCTGAAGGG - Intergenic
1046569630 8:115947076-115947098 AGTGACATGCAAAAGAAGAAAGG + Intergenic
1046675904 8:117108317-117108339 CATGACAAGAATAAGCAGAATGG + Intronic
1046860236 8:119083212-119083234 CATTACAGGGGAAAGCAGAATGG - Intronic
1046989221 8:120430639-120430661 CAACACATGCAAAGGCAGAAAGG + Intronic
1047065421 8:121276630-121276652 CATGTAATGCAAAAGCAGATAGG - Intergenic
1048978316 8:139688121-139688143 CAAAACATGCTAAAGGAGATAGG + Intronic
1051672129 9:19521489-19521511 TAGGAGATGCTAAAGGAGAATGG - Intronic
1052380108 9:27761229-27761251 CAAAACATTCTAAAGCAAAAAGG - Intergenic
1058839229 9:108890157-108890179 CATAAATTTCTAAAGCAGAAAGG + Intronic
1186538564 X:10375199-10375221 CATGACATGTGAAAGCATAGGGG - Intergenic
1187870012 X:23756984-23757006 CATGAAATTCAAAACCAGAAAGG + Intronic
1188253084 X:27923732-27923754 CATGTCATAATCAAGCAGAAAGG - Intergenic
1192269002 X:69561004-69561026 CATCACATGATGAAGTAGAATGG + Intergenic
1194068420 X:89289870-89289892 CAGGACAGGCAAAACCAGAAGGG + Intergenic
1194878446 X:99219533-99219555 CCTGATATGCTAAAGCAAAATGG - Intergenic
1195782015 X:108477440-108477462 CATCACATGATAAAGGAGAAAGG + Intronic
1196135033 X:112199549-112199571 AATGAAATACAAAAGCAGAAAGG - Intergenic
1200166774 X:154041245-154041267 CATCACACGTTGAAGCAGAAAGG + Intronic
1200722563 Y:6624035-6624057 CAGGACAGGCAAAACCAGAAGGG + Intergenic