ID: 1007878707

View in Genome Browser
Species Human (GRCh38)
Location 6:45137435-45137457
Sequence CAATTACAACAACGTACACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007878705_1007878707 14 Left 1007878705 6:45137398-45137420 CCCTTAGTTTCTTTTAAAGACAT 0: 1
1: 0
2: 6
3: 76
4: 680
Right 1007878707 6:45137435-45137457 CAATTACAACAACGTACACCAGG No data
1007878706_1007878707 13 Left 1007878706 6:45137399-45137421 CCTTAGTTTCTTTTAAAGACATA 0: 1
1: 0
2: 8
3: 61
4: 531
Right 1007878707 6:45137435-45137457 CAATTACAACAACGTACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007878707 Original CRISPR CAATTACAACAACGTACACC AGG Intronic
No off target data available for this crispr