ID: 1007888156

View in Genome Browser
Species Human (GRCh38)
Location 6:45256329-45256351
Sequence CACCAGATCAATGAATGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 84}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007888156_1007888164 26 Left 1007888156 6:45256329-45256351 CCAGTACATTCATTGATCTGGTG 0: 1
1: 0
2: 0
3: 8
4: 84
Right 1007888164 6:45256378-45256400 TTCTCTGTTTCCTCACATGGAGG 0: 1
1: 8
2: 81
3: 423
4: 1354
1007888156_1007888163 23 Left 1007888156 6:45256329-45256351 CCAGTACATTCATTGATCTGGTG 0: 1
1: 0
2: 0
3: 8
4: 84
Right 1007888163 6:45256375-45256397 GATTTCTCTGTTTCCTCACATGG 0: 1
1: 0
2: 6
3: 89
4: 666
1007888156_1007888165 30 Left 1007888156 6:45256329-45256351 CCAGTACATTCATTGATCTGGTG 0: 1
1: 0
2: 0
3: 8
4: 84
Right 1007888165 6:45256382-45256404 CTGTTTCCTCACATGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007888156 Original CRISPR CACCAGATCAATGAATGTAC TGG (reversed) Intronic
902236314 1:15059738-15059760 CACCAGGTCTAGGAATGTCCAGG + Intronic
908397590 1:63740519-63740541 CACCACAGCTGTGAATGTACTGG + Intergenic
911321666 1:96421032-96421054 CACCAAAGGAATTAATGTACTGG + Intergenic
913003960 1:114609840-114609862 GACTAGAGCACTGAATGTACTGG - Intronic
917191361 1:172422544-172422566 CACCAGACCTGTGAATGTGCTGG - Intronic
1063903116 10:10755800-10755822 CACCAGTTGTATTAATGTACTGG - Intergenic
1066096768 10:32079708-32079730 CACCATAAGAATGACTGTACAGG + Intergenic
1066442993 10:35456452-35456474 CAGCAGATCATTGATTGCACAGG + Intronic
1068221071 10:54046441-54046463 CAGCAAATAAATGAATGAACAGG + Intronic
1068847816 10:61699922-61699944 CACTAAATCAATTAATGTAAAGG + Intronic
1071400299 10:85262226-85262248 CACAAGCTCAAGGAATGTATTGG + Intergenic
1079420801 11:20285700-20285722 CACCACATTAATGAATGAAAAGG - Intergenic
1083633248 11:64106385-64106407 CATCTGATGAATGAATGAACAGG - Intronic
1092395098 12:8118965-8118987 CACCAGATAACTGAATATGCTGG + Intergenic
1094741674 12:33296579-33296601 CACCACAGCTAGGAATGTACTGG - Intergenic
1095524456 12:43108904-43108926 AACCAGATCAAGGAATCTTCAGG - Intergenic
1097096082 12:56549620-56549642 CCTCAGATTAATGAATGTTCTGG + Intronic
1106116392 13:26821270-26821292 CCCGAGATCAATGTATGTAAAGG + Intergenic
1109015776 13:57011400-57011422 TATCACATCCATGAATGTACAGG + Intergenic
1110120793 13:71879153-71879175 CAACAGATCAATGAAAGGAAGGG - Intergenic
1113428870 13:110231718-110231740 CTCCAGCTCAAGGAATTTACTGG + Intronic
1118560391 14:67073891-67073913 AACTAGATTAATGAATGTACTGG + Intronic
1120798937 14:88668019-88668041 CACAAGCTCACTGAATGTTCTGG + Intronic
1128717511 15:69919514-69919536 CAGCAGATCACTGAATCTAATGG + Intergenic
1130372799 15:83300738-83300760 CATCACATCAATCAATGAACAGG - Intergenic
1130781814 15:87047815-87047837 CACCATATCCATGTATGTATGGG - Intergenic
1134262538 16:12663791-12663813 CACCAGAACAATGGCTGTAAAGG + Exonic
1144078727 17:11743049-11743071 GTACAGATCACTGAATGTACAGG - Intronic
1146466567 17:33090967-33090989 CCACAGAACAATGACTGTACTGG - Intronic
1146903971 17:36606352-36606374 CAGCAGATAAATGAATGTATGGG + Intronic
1147791194 17:43015256-43015278 CACCAGAACAAGGAAGGCACTGG + Exonic
1148426361 17:47600674-47600696 CTCCATTTCCATGAATGTACTGG + Intronic
1149235001 17:54578886-54578908 CACCACATCTATGACTGCACTGG - Intergenic
1150268655 17:63848332-63848354 TGCCAGATCACTGAATGTAAGGG + Intergenic
1153658362 18:7305144-7305166 CACCAAAACAATGAATGAGCCGG + Intergenic
1164828625 19:31303123-31303145 CACCAAATGAATGAATATACTGG + Intronic
1166386628 19:42385922-42385944 CAGCAGATCAAAAAATGTTCAGG - Intergenic
1168181875 19:54667048-54667070 CACTAGATGAATGAATGAAGGGG - Intronic
926946218 2:18190219-18190241 CTCCAAATCAATGCATGTAAAGG - Intronic
929119233 2:38470220-38470242 CACCTGATCACAGAGTGTACAGG + Intergenic
936601869 2:113904267-113904289 CACCAGATAAATGAAAATAAAGG - Intronic
936606614 2:113963935-113963957 CACTAGAACAATGAATGAAATGG + Intergenic
937282793 2:120731809-120731831 CACCAGACCACTGAATCTGCTGG + Intergenic
947692848 2:232155344-232155366 CACTAGATCCATGAATGGAGTGG - Intronic
1171142944 20:22758649-22758671 AACCAGATTCATGAATGGACAGG + Intergenic
1173279146 20:41612055-41612077 CACCAGAAAAATGAATTTCCAGG + Intronic
1174304868 20:49607995-49608017 GACCAAATGAATGAATGTATGGG - Intergenic
1178695595 21:34790817-34790839 AACCAAATCAATGAATTTAGGGG - Exonic
1180608290 22:17078354-17078376 TACCAGATTAATAAATGGACTGG + Intergenic
1182015154 22:27032888-27032910 CTCCAGATCGGTGAATTTACAGG + Intergenic
1182586599 22:31347048-31347070 CATCAGATCGATCAATGTACCGG - Intergenic
955715941 3:61829797-61829819 CACCAGCTAAATTAATCTACCGG - Intronic
956204259 3:66739454-66739476 CACCACATCAATGAAGGTAAAGG + Intergenic
958620384 3:96550914-96550936 CTCCAGATTAAGGAATGTATGGG - Intergenic
962293656 3:134160076-134160098 CGGCAGATCAGTGGATGTACCGG - Intronic
963519137 3:146343069-146343091 CTCCAGATCACTGAATGCATGGG - Intergenic
975734777 4:77370613-77370635 CACCAGATCACTGGATTTAGAGG - Intronic
979377095 4:119959842-119959864 CACCAGCTCTATCAATGTAAAGG - Intergenic
979704454 4:123705720-123705742 CATCAGATCAAAGAATGAAAGGG - Intergenic
980662210 4:135876789-135876811 ATCCAGATCAAGGAATGTACAGG + Intergenic
982718200 4:158830897-158830919 CACTAGGTGAATGAATGTATTGG + Intronic
983574169 4:169242209-169242231 CATCAGATCAATGATTGGAATGG - Intronic
987825889 5:23029966-23029988 AACCAGATCACTGACTGAACAGG - Intergenic
988046267 5:25958816-25958838 GACCAGATAAAATAATGTACAGG - Intergenic
994596291 5:101841069-101841091 CACTAGATAAATGAAGTTACAGG + Intergenic
995093324 5:108206849-108206871 CTCAAGATCAATGAAAGCACAGG - Intronic
996056365 5:118987702-118987724 CACCTGATAAATTAATGCACAGG + Intronic
1000338305 5:160258140-160258162 ATCCAGATCAATGATTGGACTGG - Intronic
1005336394 6:24800916-24800938 CAACTTATCAATGAATGTACTGG + Intronic
1007888156 6:45256329-45256351 CACCAGATCAATGAATGTACTGG - Intronic
1010062173 6:71635750-71635772 CACCACATCTGTGAATGTGCTGG + Intergenic
1010067944 6:71708156-71708178 CTCCATATAAATGAATGTATTGG - Intergenic
1011446973 6:87451584-87451606 CACCACAGCTATGAATGTGCTGG - Intronic
1012471260 6:99575224-99575246 CACCAAATCTAGGAGTGTACAGG - Intergenic
1019676560 7:2316914-2316936 CTCCAGATCAAGGAATGCACAGG - Intronic
1023655605 7:42417060-42417082 CAACAAATCAATGAATATATTGG - Intergenic
1025629754 7:63260078-63260100 CTCCAGATCAATATATGTATGGG - Intergenic
1028409253 7:90510091-90510113 CATCTGAGCAATGAATGTCCAGG + Intronic
1030011610 7:105174148-105174170 AACCAGAGCAATGAATTTAATGG - Intronic
1030915458 7:115306600-115306622 CACCAGATTAATGAAGGAAATGG + Intergenic
1031357688 7:120807599-120807621 CAACAGATCAATCTATGTCCAGG + Intronic
1038934074 8:32229111-32229133 CACCAGGTCAATTAGTGCACCGG + Intronic
1044214591 8:89594091-89594113 CACAACATCAATGAAACTACAGG + Intergenic
1044439942 8:92211202-92211224 CACCTGAACAATAAATGGACAGG - Intergenic
1050189583 9:3010614-3010636 TACCAGATCCATGCATGCACCGG - Intergenic
1054743912 9:68835113-68835135 AACAAGATCAATGATTGTTCAGG + Intronic
1055293755 9:74813022-74813044 TCCCAAATGAATGAATGTACAGG + Intronic
1185575707 X:1170539-1170561 CACCAGATTAAAGAAGGAACAGG + Intergenic
1187274364 X:17805315-17805337 CAACAGTTCAATGACTTTACTGG - Intronic
1191967494 X:66776305-66776327 CACCACATCTATGACTGCACTGG + Intergenic
1194340663 X:92701028-92701050 CACCAGAGCTGTGAATGTGCTGG + Intergenic
1198952256 X:142084522-142084544 TCCCAGATCAATGAATGATCTGG - Intergenic
1200649018 Y:5817766-5817788 CACCAGAGCTGTGAATGTGCTGG + Intergenic