ID: 1007888159

View in Genome Browser
Species Human (GRCh38)
Location 6:45256356-45256378
Sequence AATCATCATTCATGGGGAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 173}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007888159_1007888164 -1 Left 1007888159 6:45256356-45256378 CCTATTCCCCATGAATGATGATT 0: 1
1: 0
2: 0
3: 22
4: 173
Right 1007888164 6:45256378-45256400 TTCTCTGTTTCCTCACATGGAGG 0: 1
1: 8
2: 81
3: 423
4: 1354
1007888159_1007888163 -4 Left 1007888159 6:45256356-45256378 CCTATTCCCCATGAATGATGATT 0: 1
1: 0
2: 0
3: 22
4: 173
Right 1007888163 6:45256375-45256397 GATTTCTCTGTTTCCTCACATGG 0: 1
1: 0
2: 6
3: 89
4: 666
1007888159_1007888169 11 Left 1007888159 6:45256356-45256378 CCTATTCCCCATGAATGATGATT 0: 1
1: 0
2: 0
3: 22
4: 173
Right 1007888169 6:45256390-45256412 TCACATGGAGGAAGGGGTAAAGG No data
1007888159_1007888165 3 Left 1007888159 6:45256356-45256378 CCTATTCCCCATGAATGATGATT 0: 1
1: 0
2: 0
3: 22
4: 173
Right 1007888165 6:45256382-45256404 CTGTTTCCTCACATGGAGGAAGG No data
1007888159_1007888167 5 Left 1007888159 6:45256356-45256378 CCTATTCCCCATGAATGATGATT 0: 1
1: 0
2: 0
3: 22
4: 173
Right 1007888167 6:45256384-45256406 GTTTCCTCACATGGAGGAAGGGG No data
1007888159_1007888166 4 Left 1007888159 6:45256356-45256378 CCTATTCCCCATGAATGATGATT 0: 1
1: 0
2: 0
3: 22
4: 173
Right 1007888166 6:45256383-45256405 TGTTTCCTCACATGGAGGAAGGG 0: 1
1: 23
2: 312
3: 1069
4: 2193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007888159 Original CRISPR AATCATCATTCATGGGGAAT AGG (reversed) Intronic
900936617 1:5770146-5770168 AATCAGAATTCATGGAGCATAGG + Intergenic
906409582 1:45567994-45568016 CATCAGCATTCTTGGGGAAGGGG - Exonic
909777522 1:79500921-79500943 AAAAATTATTCATGAGGAATGGG + Intergenic
909855367 1:80522830-80522852 AATAATCAATCATGGAAAATGGG - Intergenic
911038971 1:93577607-93577629 AATCATCAGCCATGTGGAAAGGG + Intronic
912119172 1:106448634-106448656 AATAATCACTCTTGGGAAATTGG - Intergenic
912143564 1:106762394-106762416 AGCCATCATTCAAAGGGAATAGG + Intergenic
912902420 1:113666665-113666687 ATTCGTGATTCATGGGGAAGAGG - Intronic
915668514 1:157466821-157466843 AATCTTCATGCATGTGGAGTGGG + Intergenic
917886209 1:179387759-179387781 ACTCATGATTCATGGGACATTGG - Intronic
918769078 1:188529640-188529662 ATTCATAATTCATGTGGAACTGG + Intergenic
918773812 1:188601862-188601884 AATCATCTATCATGGTGAAGGGG + Intergenic
919874722 1:201855646-201855668 AATGATCATTCCTGAGGAATTGG - Intronic
920303778 1:205005914-205005936 AGTCATCATTCCAGGGGAAAGGG - Intronic
921246381 1:213246243-213246265 AAACATCATTCATGGTAAATGGG + Intronic
923109050 1:230876504-230876526 AACCTTCAACCATGGGGAATAGG - Intergenic
923315903 1:232779836-232779858 GATCATCATTTATGAGGAAGTGG - Intergenic
1063423320 10:5931643-5931665 ATACATCATTCATGGAGAAATGG - Intronic
1063529444 10:6817229-6817251 AATCATCAATTCTGGGGAAGAGG - Intergenic
1066686260 10:37984365-37984387 AATCATAATTCATGAGCACTGGG + Intergenic
1068941746 10:62687529-62687551 ACTCATGATTCATGGTGATTTGG + Intergenic
1070337194 10:75466366-75466388 AACCATCATTCCAGGGGGATGGG + Intronic
1071872381 10:89809456-89809478 AACCATCAAGAATGGGGAATTGG + Intergenic
1078884730 11:15489085-15489107 ACTGATAATTCATGGTGAATAGG - Intergenic
1080417885 11:32086616-32086638 ACTCATCATTCATGGGGCACTGG - Intronic
1082624722 11:55469225-55469247 CATAAACCTTCATGGGGAATTGG + Intergenic
1083093979 11:60230411-60230433 AGTAATCCTTCATGGGGAAGTGG - Intronic
1088124358 11:106405460-106405482 ACTCACCACTCTTGGGGAATAGG + Intergenic
1088222362 11:107582586-107582608 AATCAGAATCCTTGGGGAATGGG - Intergenic
1088734474 11:112717251-112717273 TCTCATAATTCATGGGGCATTGG - Intergenic
1090276345 11:125422453-125422475 AAACATCACTCCTGGGGAGTTGG - Intronic
1090515918 11:127426651-127426673 ATAAATCATTCTTGGGGAATTGG + Intergenic
1091691710 12:2601728-2601750 AAGCACCATCCATGGGGAACAGG - Intronic
1093357526 12:18186209-18186231 ACTCATCATTGATGGGGTAAAGG - Intronic
1095408479 12:41894662-41894684 AGTCATCATCTATGAGGAATAGG - Intergenic
1098062343 12:66576300-66576322 AATCAGCATGCATGGGTAAAAGG + Intronic
1098362708 12:69670517-69670539 AACCATCACTGATGGGGATTAGG + Intronic
1099056355 12:77846056-77846078 AATCTTCGTTCATCCGGAATTGG - Intronic
1099221688 12:79922441-79922463 GTTCATCATTGATGGGGATTTGG - Intronic
1100408193 12:94289327-94289349 AATCATCAATGGAGGGGAATTGG - Intronic
1100506132 12:95222063-95222085 TCTCTTTATTCATGGGGAATTGG - Intronic
1100580292 12:95932691-95932713 ATTGATCATTCGTGGAGAATTGG - Intronic
1100879059 12:98996073-98996095 AATCATAACTCATGGGACATTGG + Intronic
1101668322 12:106841386-106841408 AATATTCATTCTTGGGGAAGTGG + Intronic
1103235534 12:119369360-119369382 AAACAGCATTCCTGGGGGATGGG + Intronic
1109657099 13:65407405-65407427 ACTCATAATTTATGGGAAATTGG - Intergenic
1110311856 13:74058890-74058912 AATGATCATTTATGGGTGATGGG - Intronic
1110588310 13:77221805-77221827 CCTCAGCATCCATGGGGAATTGG + Intronic
1110608228 13:77458780-77458802 AATCATCAATCATGAAGATTAGG - Intergenic
1111120776 13:83846121-83846143 AACCCTCATTCATAGGGAAGTGG + Intergenic
1113092123 13:106627266-106627288 AATCATGATTCAAGGGGGGTGGG - Intergenic
1113656374 13:112070063-112070085 AATCTTAATTGCTGGGGAATTGG - Exonic
1113716609 13:112513360-112513382 GATCATCTTACATGAGGAATGGG + Intronic
1115242356 14:31262099-31262121 AGTCCTCATTCATGGGGCAGGGG - Intergenic
1117809411 14:59530626-59530648 AATAATAATACATGGGTAATTGG - Intronic
1120118893 14:80654068-80654090 AATGAACATTCATGGGCAGTAGG + Intronic
1122391512 14:101390770-101390792 CCTCAGCATACATGGGGAATTGG - Intergenic
1122896779 14:104761652-104761674 AAACATCATTCATGGAGAACAGG + Intronic
1124958307 15:34374613-34374635 TATCATCATTCATGGGGAGCTGG + Intergenic
1125153307 15:36558747-36558769 ATTCTTCATTCATGGGAAAAAGG + Intergenic
1127009412 15:54605850-54605872 AAACATCATTCATGGACATTAGG + Intronic
1127977962 15:64012755-64012777 AATGATCACTTATGAGGAATAGG + Intronic
1128365601 15:66999473-66999495 ATTCATCATTGATGGGCATTTGG - Intergenic
1130171506 15:81519451-81519473 AATGGTGAGTCATGGGGAATGGG + Intergenic
1130206583 15:81881073-81881095 AATAATCATTTCTGGGAAATGGG - Intergenic
1130297908 15:82660112-82660134 AATCATCAGTCTTGGGGAGAAGG + Intronic
1131571205 15:93538509-93538531 AATTCTCATTCATTGTGAATAGG - Intergenic
1138715420 16:59016668-59016690 ATTCATAATTCACGGGGCATTGG + Intergenic
1141184465 16:81777487-81777509 AGTCATTTTTCCTGGGGAATTGG + Intronic
1143352724 17:6300454-6300476 CCTCATCATCCATGGGGAATTGG - Intergenic
1144297901 17:13896696-13896718 AATCCTCATTTATTGGGAACTGG - Intergenic
1147497374 17:40929711-40929733 AATCATAATTAATGATGAATTGG - Intronic
1147947605 17:44088769-44088791 ACTCTTCATTCATGGGGAAGAGG - Intronic
1154075632 18:11198256-11198278 CCTCATAATTCATGGGGCATCGG - Intergenic
1156074072 18:33251237-33251259 AATAATGATTCATGGGAAAAAGG + Intronic
1156147968 18:34208887-34208909 TATCATAATTCATTGGGAAAGGG + Intronic
1156354143 18:36327143-36327165 AAAGATCACTCTTGGGGAATTGG - Intronic
1156539017 18:37891694-37891716 AATCATCTTTTATGTGAAATGGG - Intergenic
1158679594 18:59555121-59555143 TCTCATTATTCATGTGGAATGGG - Intronic
1158703176 18:59767335-59767357 CATCATCATCCATGAGAAATTGG + Intergenic
1159329372 18:66970259-66970281 ATTCATCATTAATGGGCATTTGG + Intergenic
1159437141 18:68432794-68432816 AATCTTAATTCATGGGTGATAGG + Intergenic
1161093532 19:2375658-2375680 AATCATCACTGATGGGGAGAGGG + Intergenic
1167523105 19:49968840-49968862 AATCCTCAGCCTTGGGGAATCGG + Intergenic
925518998 2:4720036-4720058 AATCATGATCCATGGGCAGTTGG - Intergenic
926176185 2:10594248-10594270 AAGCAGCATTTAAGGGGAATTGG + Intronic
929017515 2:37513586-37513608 AATCATGATCTCTGGGGAATGGG + Intergenic
929630669 2:43458351-43458373 AATCATCATTCAGGTGGCATTGG - Intronic
934917807 2:98314435-98314457 AAATATTATTCATGGGGCATCGG + Intergenic
936805132 2:116322537-116322559 CATCATCATCCATGGGGTATTGG - Intergenic
938905095 2:135829559-135829581 ATTCATCATTAATGTGGAAAAGG + Intronic
938963633 2:136365491-136365513 ATTCATCATTGATGGGCATTTGG + Intergenic
939945513 2:148405405-148405427 CTTCATAATTCATGGGGCATAGG - Intronic
941014895 2:160344414-160344436 AAACATCATAGATAGGGAATGGG - Intronic
941777395 2:169407792-169407814 AATCATCATTCTGGGGTAATAGG - Intergenic
943111219 2:183608392-183608414 AATCATCATTCTAGTGGACTTGG - Intergenic
944588339 2:201193170-201193192 AAACATCATGCATGGCCAATTGG - Intronic
945056786 2:205876256-205876278 AATTATCATTCACATGGAATAGG + Intergenic
947129947 2:226911359-226911381 AATTGGCATTCATAGGGAATTGG + Intronic
947484562 2:230536310-230536332 ATTCCTCAATCATGGGGAACTGG - Intronic
948188484 2:236040556-236040578 AATCATCATGCATGGGGCGGGGG - Intronic
1170362051 20:15557054-15557076 AATCATAATTAAAGAGGAATTGG + Intronic
1170509278 20:17060092-17060114 AATCTTCCTAAATGGGGAATTGG - Intergenic
1171114947 20:22517282-22517304 AATCATGATGCCTGGGGAACCGG + Intergenic
1177481215 21:21691796-21691818 AATCATCATTTATGGTAAATTGG - Intergenic
1181889721 22:26051680-26051702 AATGATTACCCATGGGGAATAGG - Intergenic
1181926447 22:26362910-26362932 AATCACCATACATGAAGAATCGG - Intronic
1185187452 22:49410390-49410412 AAACATCTTTCATGGTGAAATGG - Intergenic
949161076 3:882674-882696 AAGCATGATTCATGGAGAAGTGG + Intergenic
949677760 3:6476814-6476836 AATAATCCTTTCTGGGGAATAGG - Intergenic
951715027 3:25633228-25633250 AATTATCATTCCTGAGGAGTGGG - Intronic
952279152 3:31906596-31906618 AATCCTGATTGATTGGGAATTGG - Intronic
953252654 3:41260747-41260769 AATCTGCATTCATGGGGACCTGG - Intronic
955659795 3:61285809-61285831 AATAACCATTAATGGGGAACTGG + Intergenic
959854143 3:111128464-111128486 AATGATCATTAATAGGCAATTGG - Intronic
960872207 3:122261283-122261305 AAGAATCATCCATTGGGAATTGG + Intronic
961074855 3:123972978-123973000 AGGCATCATTCATGAGGAACAGG - Intronic
961308823 3:125979503-125979525 AGGCATCATTCATGAGGAACAGG + Intronic
964692320 3:159463956-159463978 AATGATCATCCATGGGGGACTGG - Intronic
965280590 3:166747364-166747386 AAGCATAATTCAGGGGGAAAAGG - Intergenic
965441198 3:168717167-168717189 AATGATCATCCATGGGAAATTGG + Intergenic
965505076 3:169506424-169506446 CTTCATCATTCTTGGGTAATTGG + Intronic
967474942 3:189905928-189905950 AATCATAATTTATGGGCAGTAGG - Intergenic
969008765 4:4043521-4043543 ACTGATCATTCATGGGGAAATGG - Intergenic
973156812 4:46965358-46965380 AACCATCTTTGATGGAGAATTGG + Intronic
974462890 4:62210811-62210833 AATCATTCTTCATGAGGCATAGG - Intergenic
976222333 4:82767034-82767056 CCTCATAATTCATGGGGCATTGG - Intronic
976343878 4:83977455-83977477 AGACATAATTCATGGGGACTTGG - Intergenic
978601833 4:110436871-110436893 ATTTATCATTCAAGGGGAAGGGG - Intronic
979731665 4:124030315-124030337 TTTCATCCTCCATGGGGAATAGG + Intergenic
979899193 4:126196305-126196327 AATCCTCAGTGTTGGGGAATGGG - Intergenic
982079760 4:151778070-151778092 AGGCATCATCCATGAGGAATGGG - Intergenic
986127829 5:4899698-4899720 AATCATCATTCACTGGACATGGG - Intergenic
986594430 5:9406014-9406036 CATCATCATTCATGGTAAATTGG - Intronic
989284200 5:39680104-39680126 ATTCAGTATTCATGGGGGATTGG - Intergenic
990402284 5:55451097-55451119 AATCATCACTCTTGGTGACTAGG + Intronic
990617167 5:57519936-57519958 AATCATGCTTAATAGGGAATTGG - Intergenic
991503160 5:67297716-67297738 AAACATCACTGATGGGTAATGGG - Intergenic
992491647 5:77250366-77250388 AATCATCATAGAGGGAGAATGGG - Intronic
992629151 5:78664187-78664209 CATCAGCATCCATGGGGGATTGG - Intronic
993911349 5:93688800-93688822 GATCAGCTTTCATGGGTAATAGG - Intronic
994747032 5:103691126-103691148 AATCAGCATTTATTGTGAATTGG + Intergenic
997069603 5:130605513-130605535 CCTCATCTTTCATGGTGAATGGG + Intergenic
997182997 5:131851920-131851942 CCTCAGTATTCATGGGGAATTGG - Intronic
998126670 5:139628258-139628280 AAACATCATTCATGTGAACTAGG + Exonic
999593309 5:153173013-153173035 AAACTTCATTCATGGGGCACTGG + Intergenic
999817421 5:155191600-155191622 AATCATGACAGATGGGGAATAGG + Intergenic
1005161918 6:22874073-22874095 ATTCATCATTCTTAGAGAATTGG + Intergenic
1007673842 6:43578877-43578899 CATCATTAGTCATGGGGAAATGG - Intronic
1007888159 6:45256356-45256378 AATCATCATTCATGGGGAATAGG - Intronic
1008118351 6:47579991-47580013 ATTCCTCATCCATGGGGAAAAGG - Intronic
1011250000 6:85361269-85361291 AATCATTATTCATGGTGCTTTGG - Intergenic
1011845298 6:91555607-91555629 TCTCATAATTCATGGGGAATTGG + Intergenic
1012534527 6:100279695-100279717 CCTCAGCATCCATGGGGAATTGG - Intergenic
1013462449 6:110387951-110387973 AATTATAATTCAAGGGGAACAGG + Intergenic
1014173070 6:118300375-118300397 ACTCAGTATCCATGGGGAATTGG - Intronic
1019871727 7:3770022-3770044 AGTCTCCATTCATGGAGAATAGG + Intronic
1020686790 7:11306480-11306502 AAGCAACATTCTTGGGGAAAAGG - Intergenic
1020964768 7:14851520-14851542 TATCATCATTCTTGGAAAATAGG - Intronic
1021237759 7:18163894-18163916 AATCAACATTCTTGGGGAGCAGG - Intronic
1021260520 7:18451195-18451217 AAGCATCGTCCATGAGGAATGGG + Intronic
1021535025 7:21694023-21694045 AACCACCATTCATGAAGAATGGG + Intronic
1022600773 7:31757063-31757085 AATGAACAATCATAGGGAATTGG + Intronic
1023974399 7:45017133-45017155 AAACATCTGTCATGGGGATTTGG + Intronic
1024600967 7:50981331-50981353 AATGTTCAATCATAGGGAATTGG - Intergenic
1026476858 7:70743879-70743901 AATCATCATTTCTAGGGTATAGG + Intronic
1027329377 7:77075647-77075669 AATCATAACTCATGGGGCATTGG - Intergenic
1029537673 7:101165648-101165670 AATGTTCATTCATGGGGAAGCGG + Intergenic
1029786385 7:102795719-102795741 AATCATAACTCATGGGGCATTGG + Intronic
1032221581 7:129998549-129998571 ACTCCTCATTCCTAGGGAATTGG - Intergenic
1033925430 7:146453314-146453336 TCTCATAATTCATGGGGCATGGG + Intronic
1034756553 7:153627176-153627198 AATAAAGATTCATGGGGAAGTGG + Intergenic
1035073945 7:156165798-156165820 AACAATCATTCATGGTGAAGTGG - Intergenic
1037799067 8:22022203-22022225 AATCCTGATTCCTAGGGAATCGG + Intergenic
1039419895 8:37428406-37428428 AATGATCACTCTTGGGGAATAGG + Intergenic
1045269264 8:100648529-100648551 AATCACTATTCATGGGGGAGTGG + Intronic
1048749622 8:137657483-137657505 GAGCATAATGCATGGGGAATTGG - Intergenic
1051063546 9:13074051-13074073 CCTCATGATTCCTGGGGAATTGG + Intergenic
1056179185 9:84065054-84065076 AATCCACATTGAAGGGGAATTGG + Intergenic
1056477906 9:86970550-86970572 CCTCATCATTCCTAGGGAATTGG - Intergenic
1056858769 9:90160411-90160433 TTTCATCATTCATGGGAAACTGG + Intergenic
1056896530 9:90555911-90555933 AATCATCACACATGGGAACTAGG + Intergenic
1058271834 9:102982046-102982068 AGTCATCATTTATGAGGAATGGG + Intergenic
1059258960 9:112957538-112957560 AAGCAGCACTCATGGGGACTTGG + Intergenic
1061090247 9:128421908-128421930 AGTCTTCATTTCTGGGGAATTGG + Intronic
1185911900 X:3989133-3989155 TATCATCATTGATGGGCATTTGG + Intergenic
1187627055 X:21126902-21126924 AATAATCATTGATGTGAAATTGG + Intergenic
1187791005 X:22950301-22950323 AATCATAACTGATGGGGGATGGG - Intergenic
1189957386 X:46289116-46289138 TATCATCATTCATGGTGATCTGG + Intergenic
1190545996 X:51528069-51528091 CCTCAGTATTCATGGGGAATTGG + Intergenic
1193727112 X:85055164-85055186 CCTCATCAATCATGAGGAATAGG + Intronic
1193730842 X:85100931-85100953 TATGACCATTCATGGGGAAAAGG + Intronic
1193881209 X:86923606-86923628 AATCATCATTTTTGTGTAATGGG + Intergenic
1195097033 X:101512508-101512530 CATCATCATTCATGGGAGATTGG + Intronic
1196501074 X:116383242-116383264 ACTCATAATTCATGGGGCATTGG - Intergenic
1199271895 X:145893752-145893774 AATTATCTGTCATGGGGATTTGG + Intergenic