ID: 1007888160

View in Genome Browser
Species Human (GRCh38)
Location 6:45256362-45256384
Sequence CAGAGAAATCATCATTCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 249}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007888160_1007888164 -7 Left 1007888160 6:45256362-45256384 CCCCATGAATGATGATTTCTCTG 0: 1
1: 0
2: 2
3: 21
4: 249
Right 1007888164 6:45256378-45256400 TTCTCTGTTTCCTCACATGGAGG 0: 1
1: 8
2: 81
3: 423
4: 1354
1007888160_1007888170 29 Left 1007888160 6:45256362-45256384 CCCCATGAATGATGATTTCTCTG 0: 1
1: 0
2: 2
3: 21
4: 249
Right 1007888170 6:45256414-45256436 TCCCTCAAGCCTCTTTTATAAGG 0: 24
1: 77
2: 242
3: 596
4: 1262
1007888160_1007888165 -3 Left 1007888160 6:45256362-45256384 CCCCATGAATGATGATTTCTCTG 0: 1
1: 0
2: 2
3: 21
4: 249
Right 1007888165 6:45256382-45256404 CTGTTTCCTCACATGGAGGAAGG No data
1007888160_1007888169 5 Left 1007888160 6:45256362-45256384 CCCCATGAATGATGATTTCTCTG 0: 1
1: 0
2: 2
3: 21
4: 249
Right 1007888169 6:45256390-45256412 TCACATGGAGGAAGGGGTAAAGG No data
1007888160_1007888172 30 Left 1007888160 6:45256362-45256384 CCCCATGAATGATGATTTCTCTG 0: 1
1: 0
2: 2
3: 21
4: 249
Right 1007888172 6:45256415-45256437 CCCTCAAGCCTCTTTTATAAGGG No data
1007888160_1007888166 -2 Left 1007888160 6:45256362-45256384 CCCCATGAATGATGATTTCTCTG 0: 1
1: 0
2: 2
3: 21
4: 249
Right 1007888166 6:45256383-45256405 TGTTTCCTCACATGGAGGAAGGG 0: 1
1: 23
2: 312
3: 1069
4: 2193
1007888160_1007888167 -1 Left 1007888160 6:45256362-45256384 CCCCATGAATGATGATTTCTCTG 0: 1
1: 0
2: 2
3: 21
4: 249
Right 1007888167 6:45256384-45256406 GTTTCCTCACATGGAGGAAGGGG No data
1007888160_1007888163 -10 Left 1007888160 6:45256362-45256384 CCCCATGAATGATGATTTCTCTG 0: 1
1: 0
2: 2
3: 21
4: 249
Right 1007888163 6:45256375-45256397 GATTTCTCTGTTTCCTCACATGG 0: 1
1: 0
2: 6
3: 89
4: 666

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007888160 Original CRISPR CAGAGAAATCATCATTCATG GGG (reversed) Intronic
900324309 1:2100522-2100544 CAGAGACATCATCGCCCATGGGG - Intronic
900766227 1:4507563-4507585 AAGACAAACCATCTTTCATGGGG + Intergenic
904338944 1:29820213-29820235 CTGAGAAAGAATCATTCAAGAGG - Intergenic
908447792 1:64217485-64217507 CATAGAAATCAACATTCACAAGG - Intronic
908931443 1:69320778-69320800 CAGAGAAATCAAGATGAATGTGG + Intergenic
911788497 1:101980974-101980996 CAGAGAAATGAGCAGACATGAGG - Intronic
912577592 1:110687681-110687703 CCAAGAGATCATCATTCATCAGG - Intergenic
914350598 1:146836346-146836368 CAGAGAAGTCCTCATACATTAGG - Intergenic
915096092 1:153463687-153463709 CACAGCCATCATCATTCACGGGG - Intergenic
916235891 1:162587763-162587785 CACAGAATTCATCTTTCCTGAGG + Intronic
919766574 1:201131425-201131447 CTGGGAAACCAACATTCATGGGG + Intergenic
920653587 1:207857213-207857235 CAGAGCAATCATCTCTAATGTGG + Intergenic
921835479 1:219773840-219773862 AAGAAAAATCACCAATCATGTGG + Intronic
922747303 1:228051599-228051621 CACAGAAGGCATCATCCATGAGG - Intronic
923400537 1:233612100-233612122 CAGAGACCTCTTCATTCATGAGG - Intergenic
924539406 1:244967579-244967601 CAGAGAAATACTGATTAATGTGG + Intergenic
924942706 1:248823420-248823442 CATAAAAATCATAAATCATGGGG + Intronic
1064137670 10:12764697-12764719 CAGAGAAAACATGAACCATGTGG + Intronic
1064549793 10:16488064-16488086 CAGAGAAGTCAGTATTAATGGGG + Intronic
1064576248 10:16748804-16748826 CAGAGAAACCCTCACTCATAGGG - Intronic
1066583282 10:36903753-36903775 CAGAAAAATCATGAGTTATGAGG + Intergenic
1066789367 10:39045731-39045753 CAGAGGAATCAGAATTAATGAGG - Intergenic
1067013873 10:42740889-42740911 CAGAGAAACCCTCACTCATAGGG + Intergenic
1067309906 10:45102860-45102882 CAGAGAAACCCTCACTCATACGG - Intergenic
1069183720 10:65396019-65396041 CAGAGAAATCAGGAATGATGAGG + Intergenic
1070368216 10:75756868-75756890 CAGAGTCATCATCAGTAATGTGG - Intronic
1070718079 10:78737026-78737048 CATAGAAAGCAACATCCATGAGG + Intergenic
1070936526 10:80302327-80302349 CAGAGAAAGCAGCATTCAAATGG + Intergenic
1072256523 10:93626576-93626598 CAAAGAAATCATTTTTCATTGGG - Intronic
1074577880 10:114687785-114687807 CAAAGGAATCATTTTTCATGTGG - Intergenic
1079561946 11:21832502-21832524 CACAGAAACCATCTTTCATTTGG - Intergenic
1084397353 11:68921215-68921237 CTAAGAAATCTTCAATCATGGGG - Intronic
1085199219 11:74691637-74691659 GAGAGAAATCAAATTTCATGTGG + Intergenic
1085548896 11:77348469-77348491 CAGTGAAATCCTCATTTATTTGG - Intronic
1086226533 11:84518068-84518090 AAGAGACATCATCACTCACGAGG + Intronic
1086988522 11:93276817-93276839 CAGATAAATATTTATTCATGTGG + Intergenic
1087422965 11:97954955-97954977 CAGAGGAATAATAATTAATGAGG - Intergenic
1088375690 11:109139188-109139210 CAGAAAAAGCATCATTAAAGTGG - Intergenic
1090512149 11:127386846-127386868 GGGAGACATCAGCATTCATGTGG - Intergenic
1093187596 12:16038915-16038937 CATAGCAATCAACATTAATGAGG - Intergenic
1094747769 12:33365681-33365703 CAGAGAAAACTTCAACCATGTGG - Intergenic
1095202393 12:39399464-39399486 AAGAGAAATCTACATTGATGAGG + Intronic
1095408480 12:41894668-41894690 CACAGAAGTCATCATCTATGAGG - Intergenic
1097454251 12:59777002-59777024 CAGAGAAGTTACCATGCATGAGG + Intronic
1098005405 12:65992026-65992048 CAGAGAAAGCTTCACTCAGGAGG + Intergenic
1099770226 12:87042985-87043007 CAGAGATATCATGAATCTTGGGG - Intergenic
1101722946 12:107366299-107366321 CAGAGAAAGCATCGTACATAAGG + Intronic
1101772651 12:107765838-107765860 CAGAGAAGTCATCACTCAAAAGG + Intergenic
1102269399 12:111519482-111519504 CAGAGAAAACCTCATTGAGGAGG - Intronic
1102746038 12:115250026-115250048 CAGACAAATCATTATTCATGTGG + Intergenic
1102828727 12:115974709-115974731 CAAAGAAATCCTGTTTCATGAGG - Intronic
1105620229 13:22059572-22059594 CAGAGAAAGCTTCATTCAGAAGG + Intergenic
1105845110 13:24287053-24287075 CGGAGAAATGAGCATACATGTGG - Intronic
1106693393 13:32144804-32144826 CAGAGAACCTATCATTTATGTGG + Intronic
1110157069 13:72330236-72330258 CACAGAAATCATTAGTCATTAGG + Intergenic
1110423401 13:75338554-75338576 CAAAGAAATGATCATACAGGAGG - Intronic
1111120775 13:83846115-83846137 CAGAGGAACCCTCATTCATAGGG + Intergenic
1111509460 13:89242087-89242109 CAGAGAGATTCTCATTCCTGAGG + Intergenic
1111592831 13:90371774-90371796 CAGAGAAAACATCATTTTGGTGG - Intergenic
1113657366 13:112075724-112075746 CAGAGAAATCACTATTAATATGG - Intergenic
1113994650 14:16056193-16056215 CTGGGAATTCCTCATTCATGGGG - Intergenic
1116255835 14:42554163-42554185 CAGAAAAAGCATCATCCATCTGG + Intergenic
1118042940 14:61937112-61937134 CAGAGACATCACCATCCACGGGG - Intergenic
1120594125 14:86413202-86413224 CAAAAAAATCATAAATCATGTGG + Intergenic
1120935998 14:89896014-89896036 GAGAGAACTCATCATCCATCAGG + Intronic
1121558318 14:94855432-94855454 GAGAGGAATCACCACTCATGGGG + Intergenic
1123700942 15:22914405-22914427 AAGAGAAATCATGTTTCCTGGGG - Intronic
1124127705 15:26952151-26952173 CAGTCACATCATCATTCAGGTGG - Intergenic
1124958306 15:34374607-34374629 TGAAGATATCATCATTCATGGGG + Intergenic
1126900416 15:53308976-53308998 CTGAGAAATCCTCCTTCATAGGG + Intergenic
1127280945 15:57492122-57492144 CAGATAAGTCATCATACCTGAGG - Intronic
1127565949 15:60188404-60188426 CAGGGAAATCATCATTCTCTTGG + Intergenic
1128273496 15:66333186-66333208 CAAAGTAAACATCATTCAGGAGG + Exonic
1129544919 15:76385669-76385691 CAGTGACAACATCATTCATCAGG + Intronic
1131414633 15:92243476-92243498 CAGAGAAATCCTGTTTGATGTGG - Intergenic
1132617775 16:850831-850853 CAGAGAAATCGTCCCACATGTGG - Intergenic
1132617790 16:850924-850946 CCGAGAAATCATCCCACATGCGG - Intergenic
1134504579 16:14794627-14794649 AAGAGCAAACATCCTTCATGGGG + Intronic
1134575992 16:15334282-15334304 AAGAGCAAACATCCTTCATGGGG - Intergenic
1134726451 16:16422219-16422241 AAGAGCAAACATCCTTCATGGGG + Intergenic
1134940980 16:18289640-18289662 AAGAGCAAACATCCTTCATGGGG - Intergenic
1136155651 16:28380300-28380322 CAGCAAAATGATCATTAATGAGG - Exonic
1136207433 16:28734989-28735011 CAGCAAAATGATCATTAATGAGG + Exonic
1137448079 16:48544519-48544541 AAGAGTAAACATCAGTCATGGGG + Intronic
1138368756 16:56507143-56507165 CAGCAAAATCATGATTCATTTGG - Intronic
1139983438 16:70879193-70879215 CAGAGAAGTCCTCATACATTAGG + Intronic
1140322241 16:73964319-73964341 CAGAGAAACCTTGATTCCTGGGG - Intergenic
1140690213 16:77476189-77476211 CAGAGAAATTATGAATTATGGGG - Intergenic
1140757722 16:78083534-78083556 CAGAGAAAACACAATTCATTTGG + Intergenic
1140914344 16:79481402-79481424 CAGAGAAATCACTATTCATGGGG - Intergenic
1142901821 17:3017040-3017062 CAGAGAGAGCATCATCCAGGGGG + Intronic
1144284958 17:13764983-13765005 CATAGAAATGCCCATTCATGAGG + Intergenic
1144332169 17:14234905-14234927 AAGAAAAATGATCTTTCATGTGG - Intergenic
1145015591 17:19395384-19395406 CTGACAATTTATCATTCATGGGG + Intergenic
1147165097 17:38588876-38588898 CAGAGACACCACCTTTCATGGGG + Intronic
1149268780 17:54954715-54954737 GAGAGGAAGCATCAGTCATGTGG - Intronic
1150811442 17:68360255-68360277 CAAAGAAATCAGCATTTCTGGGG - Intronic
1151351713 17:73535849-73535871 CAGAGTGATCATTGTTCATGTGG + Intronic
1157276129 18:46312154-46312176 GTGAGAAAGCAGCATTCATGGGG - Intergenic
1157922384 18:51726739-51726761 CAGAGAAATCACCACTCACTTGG + Intergenic
1159247162 18:65821875-65821897 CAGAGAAAACATTATTAACGTGG - Intronic
1164530671 19:29046068-29046090 CAGAACAAGCCTCATTCATGGGG + Intergenic
1165174797 19:33920740-33920762 TAGAGAAATCATCATCCTTTAGG + Intergenic
1166567253 19:43772738-43772760 CAGGGAAAGCTTCATTCATGAGG + Intronic
1166582774 19:43917000-43917022 CAGAGAAAACATTATTCCCGAGG - Intronic
925552152 2:5087851-5087873 CAGCCAAATATTCATTCATGTGG - Intergenic
925984234 2:9202718-9202740 TAGAGAAAGTATCATTCATGCGG - Intergenic
925990293 2:9249364-9249386 CAGAGAAATGAACATATATGGGG - Intronic
928044694 2:27917485-27917507 CAGAGAAGGCATCATCTATGAGG - Intronic
929400043 2:41569020-41569042 CAGAAAAAAAATCAGTCATGTGG + Intergenic
929590518 2:43142832-43142854 CAAAGAAGTCAGTATTCATGGGG - Intergenic
929630670 2:43458357-43458379 CAATGAAATCATCATTCAGGTGG - Intronic
930068619 2:47347410-47347432 GAGAGACATCAGCATCCATGTGG + Intronic
931439850 2:62281057-62281079 CAGAAAAATCAACATTTTTGGGG + Intergenic
933248555 2:80002952-80002974 CAGAGAAATCATGCCACATGGGG - Intronic
933294531 2:80474019-80474041 CAGAGAACTGATCATCCAAGGGG - Intronic
934624963 2:95838874-95838896 CAGAGAATTTATCAAGCATGGGG - Intronic
934808614 2:97262439-97262461 CAGAGAATTTATCAAGCATGGGG + Intronic
934828897 2:97494752-97494774 CAGAGAATTTATCAAGCATGGGG - Intronic
935307541 2:101751911-101751933 CACAGTGTTCATCATTCATGGGG + Intronic
937092517 2:119215938-119215960 CCCAGAAATCATCATTCCTGGGG - Intergenic
938536819 2:132254561-132254583 CTGGGAATTCCTCATTCATGGGG + Intronic
938627969 2:133132422-133132444 AAGAGAAAAGATTATTCATGTGG - Intronic
938683961 2:133718870-133718892 CAGAGGCATCATGATTCATCAGG + Intergenic
940247564 2:151635976-151635998 TAGAGAAAGATTCATTCATGTGG - Intronic
940533897 2:154913911-154913933 CAGAGAAATGATCAGTGGTGAGG + Intergenic
941361357 2:164555381-164555403 AAGAGAAATCATCATTCAGCAGG + Intronic
941754169 2:169166822-169166844 CAGTGAACTCAACATACATGTGG + Intronic
942751603 2:179293934-179293956 CAAAGAACTCATCATCCTTGGGG - Intergenic
943794932 2:191980450-191980472 CAGTGAAATCATTATTCATCTGG + Intronic
946539420 2:220667267-220667289 CATAGAAGTCATCATACATATGG - Intergenic
947889057 2:233600384-233600406 CAGAGAAAGAGTAATTCATGTGG + Intergenic
948188488 2:236040562-236040584 AGAAGAAATCATCATGCATGGGG - Intronic
1168809675 20:696732-696754 AAGAGAAATGATCATGAATGTGG - Intergenic
1171257902 20:23704968-23704990 CAGAGAAATCATCACTGCTGTGG - Intergenic
1171275063 20:23849694-23849716 CAGAGAAATCATCACTGCTGTGG - Intergenic
1171277611 20:23871389-23871411 CAAAGAGCTCATCATTCCTGTGG - Intergenic
1171896015 20:30761694-30761716 GAGAGTAATCAACATTCAGGAGG + Intergenic
1173896942 20:46558469-46558491 CTTAGAAATCATGATTCATCTGG + Exonic
1174794905 20:53513882-53513904 CAGAGCAAACATCATTCTAGAGG + Intergenic
1175005999 20:55684058-55684080 CAGAGAAATCAAAACTCCTGAGG - Intergenic
1176605837 21:8829971-8829993 GAGAGTAATCAACATTCAGGAGG - Intergenic
1179415803 21:41197793-41197815 CTGAGGTAACATCATTCATGAGG + Intronic
1179529261 21:42007775-42007797 GAGAGAAATCATCAAACTTGAGG + Intronic
1180312442 22:11251216-11251238 CTGGGAATTCCTCATTCATGGGG + Intergenic
1180348135 22:11721576-11721598 GAGAGTAATCAACATTCAGGAGG - Intergenic
1180355908 22:11839672-11839694 GAGAGTAATCAACATTCAGGAGG - Intergenic
1180382348 22:12152653-12152675 GAGAGTAATCAACATTCAGGAGG + Intergenic
1181429433 22:22869606-22869628 CAAATGGATCATCATTCATGTGG - Intronic
1185041963 22:48508790-48508812 CAGAGAAATGATCAATGTTGAGG - Intronic
949147493 3:720214-720236 CAGAGATATCATCATAAGTGAGG - Intergenic
951469579 3:23041979-23042001 CAGAGAAATTATAATACATGAGG + Intergenic
954144082 3:48625728-48625750 CAGACAAATCTTTATTCCTGAGG + Exonic
955750795 3:62184098-62184120 CAGTGTCATCATCTTTCATGGGG + Intronic
956960039 3:74388803-74388825 CAGAGAAATCATATTTTATAAGG + Intronic
957092245 3:75742539-75742561 CAGAGAATTCATGGTTCATGTGG - Intronic
959167820 3:102802627-102802649 CAGGGAAAACATTATACATGTGG + Intergenic
961074856 3:123972984-123973006 CATAGAAGGCATCATTCATGAGG - Intronic
961101161 3:124200416-124200438 CACAGAAGGCATTATTCATGAGG - Intronic
961308822 3:125979497-125979519 CATAGAAGGCATCATTCATGAGG + Intronic
962525376 3:136233441-136233463 CACAGAAATCTTCATGGATGAGG - Intergenic
962635234 3:137324598-137324620 GAGAAAAATCATCATTAATTTGG - Intergenic
964124240 3:153219273-153219295 CAGAGAAAGCATTATACTTGAGG - Intergenic
965668674 3:171123399-171123421 CAGAGAAATCAGTATTCAGTGGG - Intronic
967955017 3:194871362-194871384 CAGCGTAATCATCTTCCATGGGG + Intergenic
970013058 4:11481712-11481734 CAGAGAGAGCTTCATTGATGAGG - Intergenic
970091652 4:12415217-12415239 AAGACAAATCATAATTCAGGAGG - Intergenic
971062321 4:22986137-22986159 CAGAAACATCATCATTGATTGGG - Intergenic
971931912 4:33095564-33095586 CAGCAAAAGCATCATTCATTTGG - Intergenic
972374306 4:38456414-38456436 CAGGGAGTTCATCTTTCATGAGG - Intergenic
973372271 4:49261010-49261032 GAGAGTAATCAACATTCAGGAGG + Intergenic
974554974 4:63434588-63434610 AAGAAAAAGCATTATTCATGGGG - Intergenic
975054488 4:69912908-69912930 GAGAGAAATCATAATTTTTGTGG - Intergenic
975258056 4:72262194-72262216 AAGAGCATTCATCATTTATGTGG + Intergenic
976343879 4:83977461-83977483 CAGAGGAGACATAATTCATGGGG - Intergenic
977104104 4:92858334-92858356 CAGAACATTCATGATTCATGGGG + Intronic
981079560 4:140625119-140625141 GAGAGAAATCAACATTCATTGGG - Intronic
981237935 4:142439889-142439911 AAGAGAAGTCATCATGGATGAGG - Intronic
981602063 4:146501034-146501056 CAGAGAAAGCAGCAATAATGAGG - Intronic
982079762 4:151778076-151778098 CATAGAAGGCATCATCCATGAGG - Intergenic
983372648 4:166880912-166880934 CAGTGAATTCAACATTTATGAGG - Intronic
985061378 4:186082715-186082737 AAGAAAAATCATCAATCTTGGGG - Exonic
985122793 4:186660791-186660813 CAGACACATCATCATTTCTGGGG + Intronic
986980718 5:13445674-13445696 AAGAGAAGTCTTCATTCATTTGG + Intergenic
987110479 5:14681390-14681412 CAGAGAAAGTTTCATTCCTGTGG - Intronic
987619313 5:20319817-20319839 CAGAGAACTAATCATTTCTGGGG + Intronic
987858962 5:23459055-23459077 CAGAGAAATTTTCTTTAATGGGG - Intergenic
987934333 5:24444478-24444500 CATATAAATCAGCTTTCATGTGG - Intergenic
988149598 5:27360973-27360995 CAGAAAAATCATAATTTATAAGG + Intergenic
988335522 5:29903436-29903458 CTAAGAGATCCTCATTCATGTGG - Intergenic
989262588 5:39435128-39435150 CTGAGCAATCATTATTCAGGAGG - Intronic
991299789 5:65119274-65119296 CAGAGAATTCATCATTGTTATGG + Intergenic
992321404 5:75616555-75616577 CAAACAAAACATTATTCATGAGG - Intronic
993336630 5:86667547-86667569 CAGGGAAAGCTTCATTCCTGAGG + Intergenic
993542918 5:89174742-89174764 CAGAGAAATAATCTTTAAGGTGG - Intergenic
994323707 5:98424074-98424096 CAGAGACAACATCTATCATGAGG - Intergenic
995167668 5:109064830-109064852 TAAAGAAATGTTCATTCATGTGG - Intronic
999200995 5:149816140-149816162 CAGAGAAATCACTATTAATGTGG + Intronic
1000527479 5:162376322-162376344 TAGAGAATTCATTTTTCATGGGG - Intergenic
1000991511 5:167916467-167916489 CAGGGAAATCATCAATCCCGGGG + Intronic
1001490594 5:172152028-172152050 CAGAGAAAGCCTCTCTCATGAGG - Intronic
1001923099 5:175616261-175616283 CTGTGAAATCATCACTCAGGTGG - Intergenic
1004128038 6:12892844-12892866 AAGAGATATCATCATTGATAGGG + Intronic
1004421240 6:15472095-15472117 GAGAGACATCAAAATTCATGAGG - Intronic
1005583331 6:27253006-27253028 CAGAGAAGTCATCTTACAGGTGG + Intronic
1007284645 6:40738763-40738785 CTCAGAAATAATTATTCATGAGG - Intergenic
1007713651 6:43840500-43840522 GAGAAAAGTCATCATTCATGTGG - Intergenic
1007888160 6:45256362-45256384 CAGAGAAATCATCATTCATGGGG - Intronic
1008846032 6:55965191-55965213 AAGAAAAATCATTATTCATATGG - Intergenic
1009587272 6:65623270-65623292 CAGCGAAGTCATCATCCAGGAGG + Intronic
1009923548 6:70093094-70093116 GAGAAAAGTCTTCATTCATGAGG + Intronic
1010008671 6:71025380-71025402 CAGAAAAATCAGCATACAAGGGG - Intergenic
1012597694 6:101059068-101059090 CAGAGAAAGCCTAATTCATTTGG - Intergenic
1012625633 6:101400920-101400942 CACAGAAACAATCATTCCTGTGG - Intronic
1013824315 6:114193311-114193333 CAGGGAAGTCCTCATACATGAGG + Intronic
1014513690 6:122356099-122356121 GAGAAAACTCATAATTCATGGGG + Intergenic
1014965847 6:127749347-127749369 CATAGAAAGCATCAATCCTGTGG - Intronic
1016124291 6:140380919-140380941 CAGAGGAATCATGATACACGGGG + Intergenic
1016851091 6:148619708-148619730 CATAGGATTCCTCATTCATGTGG - Intergenic
1016877645 6:148879850-148879872 GAGTGAAATCATGTTTCATGGGG + Intronic
1018562525 6:165117429-165117451 CAGAGTAATCCTCTTCCATGTGG - Intergenic
1020484782 7:8708179-8708201 CAGAAAAATGATCAAACATGAGG + Intronic
1021119111 7:16777952-16777974 CAGATAAATAATGATTAATGTGG + Intronic
1021260518 7:18451189-18451211 CAGAGAAAGCATCGTCCATGAGG + Intronic
1021298564 7:18940967-18940989 CTTAGAAATCATCATTTATTCGG - Intronic
1021554158 7:21903021-21903043 CACAGGAATCCTCATTCATCTGG - Exonic
1021855775 7:24854077-24854099 CACACAAATCATTATTCATTAGG + Intronic
1029451355 7:100643132-100643154 CAGAAACATCACCATTAATGAGG + Exonic
1029972242 7:104800943-104800965 CAGAGAATTCCACATTCATCTGG + Intronic
1031608956 7:123802370-123802392 CAGAGAAGTCATCCTTGATATGG - Intergenic
1036234736 8:7028738-7028760 CAGAGAAAGCATCAGGCATTGGG + Intergenic
1036421866 8:8603890-8603912 CAGAGAAGTCCTCAGGCATGGGG - Intergenic
1036498752 8:9294557-9294579 GAGAGAAAACATCACTAATGAGG + Intergenic
1037843728 8:22264114-22264136 CAGTAAAATCATCAATCAGGAGG - Intergenic
1039254441 8:35703710-35703732 CAGAGTAATCTTCGTTCCTGTGG + Intronic
1041195216 8:55395422-55395444 TTGAGAAATCATAAGTCATGTGG + Intronic
1041363619 8:57077777-57077799 CACACAAATCATCAGTTATGGGG - Intergenic
1042733655 8:71964034-71964056 CAGATACCTCATAATTCATGGGG + Intronic
1042935872 8:74057628-74057650 CACAGAAATCATGATTGTTGGGG + Intergenic
1042973540 8:74437938-74437960 CAGTGAAATTCTCATACATGTGG - Intronic
1044023917 8:87144244-87144266 AAGAGAAAACATCTTTCATTTGG + Intronic
1044863285 8:96544478-96544500 CAGAGAAAACATCATTGAGGCGG - Intronic
1046146658 8:110170373-110170395 TAGAGATTTCATCAATCATGAGG + Intergenic
1046154778 8:110273845-110273867 CAGAGAAATCCTTAATCAAGAGG - Intergenic
1046486271 8:114892960-114892982 CAAAGAAATCCTCATCCATGAGG + Intergenic
1047367279 8:124222939-124222961 AAGAGAAATCATTACTTATGTGG - Intergenic
1048618059 8:136100972-136100994 CAGAGAGATGATCATACAGGTGG - Intergenic
1048699068 8:137066328-137066350 CAGTGAAATAATAATTGATGAGG + Intergenic
1050245977 9:3690269-3690291 CATATCAACCATCATTCATGTGG - Intergenic
1050524064 9:6530247-6530269 CAGAGAAAGCCTATTTCATGGGG + Intergenic
1050866891 9:10512096-10512118 CAGAAAAACCACCATTCAAGAGG + Intronic
1051023963 9:12583071-12583093 CAGATAAATCATAATTACTGGGG + Intergenic
1051610699 9:18959022-18959044 CAGAAAAATCAAAAGTCATGAGG + Intronic
1055756523 9:79564176-79564198 CTGAGAAATTTTCATTCATGGGG - Intergenic
1055836055 9:80443394-80443416 AAGAGAAATCATCTTTCGTATGG - Intergenic
1057848142 9:98541289-98541311 GAGAGAAAGCATGATTCAGGTGG + Intronic
1059678509 9:116563464-116563486 CAAAGAGATCATTGTTCATGTGG - Intronic
1060628496 9:125135196-125135218 CAAAGAAATAATAATGCATGAGG + Intronic
1061999953 9:134210914-134210936 CATTGCAATCATCATTCATGGGG + Intergenic
1203740975 Un_GL000218v1:180-202 GAGAGTAATCAACATTCAGGAGG - Intergenic
1203553231 Un_KI270743v1:181989-182011 GAGAGTAATCAACATTCAGGAGG - Intergenic
1186950034 X:14614355-14614377 CAGAGAATACATTATTCATCTGG - Intronic
1187348152 X:18486264-18486286 CAGAGAAAGCTTCATTGAAGAGG - Intronic
1187356922 X:18584205-18584227 AAAAGAAATAATAATTCATGTGG - Intronic
1190728801 X:53210773-53210795 CAGAGATATCTGCATTGATGTGG + Exonic
1194006004 X:88492487-88492509 CAAAAAAATAATAATTCATGTGG - Intergenic
1195004701 X:100674240-100674262 CTGAGAAATCATCTTTAAAGTGG - Intergenic
1195230973 X:102846734-102846756 CAAAGAACTCATGATTCATCAGG - Intergenic
1196712678 X:118779534-118779556 CCTAGAAATGATCATTCATTCGG - Intronic
1196804458 X:119572157-119572179 CAGAGGAATCGTCATTCTGGTGG - Intergenic
1199080715 X:143573953-143573975 TAGCAAAATCATCATTCAGGTGG - Intergenic
1201077514 Y:10198865-10198887 CTGGGAATTCGTCATTCATGGGG - Intergenic
1201154501 Y:11117648-11117670 GAGAGTAATCAACATTCAGGAGG - Intergenic