ID: 1007888161

View in Genome Browser
Species Human (GRCh38)
Location 6:45256363-45256385
Sequence ACAGAGAAATCATCATTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 270}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007888161_1007888172 29 Left 1007888161 6:45256363-45256385 CCCATGAATGATGATTTCTCTGT 0: 1
1: 0
2: 0
3: 19
4: 270
Right 1007888172 6:45256415-45256437 CCCTCAAGCCTCTTTTATAAGGG No data
1007888161_1007888164 -8 Left 1007888161 6:45256363-45256385 CCCATGAATGATGATTTCTCTGT 0: 1
1: 0
2: 0
3: 19
4: 270
Right 1007888164 6:45256378-45256400 TTCTCTGTTTCCTCACATGGAGG 0: 1
1: 8
2: 81
3: 423
4: 1354
1007888161_1007888170 28 Left 1007888161 6:45256363-45256385 CCCATGAATGATGATTTCTCTGT 0: 1
1: 0
2: 0
3: 19
4: 270
Right 1007888170 6:45256414-45256436 TCCCTCAAGCCTCTTTTATAAGG 0: 24
1: 77
2: 242
3: 596
4: 1262
1007888161_1007888169 4 Left 1007888161 6:45256363-45256385 CCCATGAATGATGATTTCTCTGT 0: 1
1: 0
2: 0
3: 19
4: 270
Right 1007888169 6:45256390-45256412 TCACATGGAGGAAGGGGTAAAGG No data
1007888161_1007888165 -4 Left 1007888161 6:45256363-45256385 CCCATGAATGATGATTTCTCTGT 0: 1
1: 0
2: 0
3: 19
4: 270
Right 1007888165 6:45256382-45256404 CTGTTTCCTCACATGGAGGAAGG No data
1007888161_1007888166 -3 Left 1007888161 6:45256363-45256385 CCCATGAATGATGATTTCTCTGT 0: 1
1: 0
2: 0
3: 19
4: 270
Right 1007888166 6:45256383-45256405 TGTTTCCTCACATGGAGGAAGGG 0: 1
1: 23
2: 312
3: 1069
4: 2193
1007888161_1007888167 -2 Left 1007888161 6:45256363-45256385 CCCATGAATGATGATTTCTCTGT 0: 1
1: 0
2: 0
3: 19
4: 270
Right 1007888167 6:45256384-45256406 GTTTCCTCACATGGAGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007888161 Original CRISPR ACAGAGAAATCATCATTCAT GGG (reversed) Intronic
904789169 1:33005476-33005498 ACATAGAAAGGATCATTTATTGG + Intergenic
908491137 1:64645348-64645370 ACAAAGAAATCATAAATGATTGG + Intronic
908655589 1:66384658-66384680 ACTGAAAAATCATGATTCACTGG + Intergenic
911826418 1:102491663-102491685 ACAAAGAAATCATCATACTTAGG - Intergenic
912982954 1:114394663-114394685 ACAGAGAAATGATAAGGCATTGG - Exonic
913944449 1:125145311-125145333 ACAGAAAAATCAGCTTTCTTGGG + Intergenic
915096093 1:153463688-153463710 ACACAGCCATCATCATTCACGGG - Intergenic
916265263 1:162884337-162884359 ACAGACCTCTCATCATTCATTGG - Intergenic
916417770 1:164608883-164608905 ACAGAGAAAGAATCATGAATTGG - Intronic
917657864 1:177144937-177144959 AGAGAAAAATCATCATTTTTAGG + Intronic
917861598 1:179150345-179150367 TAAGAGCATTCATCATTCATGGG + Intronic
919041426 1:192393158-192393180 ACAGAGTATCTATCATTCATTGG + Intergenic
920703728 1:208236584-208236606 ACAGAGCAATCACAATCCATAGG + Intronic
921312434 1:213857625-213857647 ACAGAGAAATAATAATTCCCTGG - Intergenic
921516388 1:216097848-216097870 AGGGAGAAGGCATCATTCATAGG - Intronic
921685463 1:218084077-218084099 ACAGAGACATAATCATACACAGG - Intergenic
921949569 1:220915415-220915437 TCAGAGGTATCAACATTCATGGG - Intergenic
1063560334 10:7120411-7120433 AAAGAGAAATCATCAGGCTTAGG - Intergenic
1063828527 10:9925772-9925794 AAAAAGAAATCTTCATTAATTGG + Intergenic
1064549792 10:16488063-16488085 ACAGAGAAGTCAGTATTAATGGG + Intronic
1064576249 10:16748805-16748827 TCAGAGAAACCCTCACTCATAGG - Intronic
1066268643 10:33800407-33800429 TCAGGGAAATCATTAATCATTGG + Intergenic
1067013872 10:42740888-42740910 TCAGAGAAACCCTCACTCATAGG + Intergenic
1067548272 10:47212733-47212755 TAAGAGAATTCATCATGCATGGG + Intergenic
1068514315 10:58007063-58007085 ACAGAGTAAACATCACTCAATGG + Intergenic
1069211301 10:65762905-65762927 ACTGAGAAATAATCATTAATTGG - Intergenic
1069665191 10:70150312-70150334 AATGAGAAGTCATAATTCATGGG + Exonic
1070345050 10:75533435-75533457 GCAGAGAAAGCATCAATCCTGGG + Intronic
1071767595 10:88686188-88686210 ACAGAGAAATGATCAATGCTTGG - Intergenic
1072256524 10:93626577-93626599 CCAAAGAAATCATTTTTCATTGG - Intronic
1072296899 10:94017368-94017390 ACTGAGAATTCATCATCCAAAGG - Intronic
1075480993 10:122781706-122781728 ACAGATAAGCCATCATCCATTGG + Intergenic
1075920426 10:126207343-126207365 ACTAAGAAATGATCATGCATTGG + Intronic
1076763715 10:132619107-132619129 TCAGAGAAGTCATCAGACATGGG - Intronic
1082242111 11:49884695-49884717 AAAAACAAATCATCATTCAAGGG - Intergenic
1082996067 11:59256493-59256515 GCAGAGAAAGCAGCAGTCATGGG - Intergenic
1083020621 11:59503557-59503579 AAAGAGAAAACATGATTCAATGG + Exonic
1083957736 11:65995080-65995102 ACTGAGAAAACATCAATCAAGGG + Intergenic
1086555416 11:88104676-88104698 ACTGAAAAATCATCATGAATTGG - Intergenic
1088542203 11:110924861-110924883 ACTGAGAAACTATCATTCAAGGG - Intergenic
1089333276 11:117704877-117704899 ATAGAGAACTCTTCATTCAGAGG + Intronic
1091808494 12:3375425-3375447 ACAGAAAAATCAGCATTAAACGG - Intergenic
1092983227 12:13818830-13818852 GCAGACAAATCATCATACAGGGG + Intronic
1094692663 12:32785349-32785371 AGAGAGAAATAAACTTTCATTGG - Intergenic
1094732276 12:33191790-33191812 ACAAAGAAAACAGCATTAATTGG - Intergenic
1095281861 12:40361213-40361235 AAATAAAAATCCTCATTCATGGG - Intronic
1095397719 12:41779513-41779535 AAAGATAAATCATCATTGAAAGG + Intergenic
1095509542 12:42935440-42935462 ACAGAGAACTTCTCATTCAAAGG + Intergenic
1096213033 12:49780969-49780991 AAATAGCATTCATCATTCATAGG - Intergenic
1096546336 12:52342719-52342741 ACGGAGAGAGCAGCATTCATGGG - Intergenic
1096634775 12:52951278-52951300 ACAGAGAAACCATCAGTGAGTGG + Intronic
1097074415 12:56382365-56382387 GCAGAGAAATCAGCTTTCAGTGG - Intergenic
1098260145 12:68661402-68661424 ACAGCTAAATATTCATTCATTGG + Exonic
1098462405 12:70746209-70746231 ACTGAGAAATCATCTCTCAGAGG - Intronic
1099003432 12:77208454-77208476 TCAGAAAATTCATGATTCATAGG - Intergenic
1100022292 12:90084152-90084174 GCTGAGAAAGCAACATTCATGGG + Intergenic
1101467397 12:104961912-104961934 AGAGAAAAACCATCATTCAGGGG + Intergenic
1102405227 12:112667627-112667649 AAAGAGCTATCACCATTCATGGG + Intronic
1102436296 12:112926592-112926614 ACAGAGAACACATGATTCAAGGG + Intronic
1103085174 12:118057253-118057275 ACAAAGAAACCCTGATTCATAGG - Intronic
1104799715 12:131546116-131546138 ACAGAGAAATCTTTATTGAAAGG + Intergenic
1105485623 13:20828438-20828460 ACAGAAAAATTATTATTCACAGG + Intronic
1106328539 13:28717719-28717741 ACCGTGAACTCATCATCCATTGG - Intronic
1108133110 13:47324943-47324965 AGAGAGAAATCTTCATGAATAGG + Intergenic
1109621603 13:64914744-64914766 ACAGATAATTCATTATTCTTAGG - Intergenic
1111120774 13:83846114-83846136 GCAGAGGAACCCTCATTCATAGG + Intergenic
1111140554 13:84112844-84112866 ACAGGCAAATAATTATTCATAGG + Intergenic
1111140763 13:84115106-84115128 ACAGGTAAATAATTATTCATAGG + Intergenic
1111767476 13:92550334-92550356 ATAGAGAAAACATAATTCTTTGG - Intronic
1112735364 13:102410093-102410115 ACGGAAAATTCATCATTCAGAGG - Intergenic
1113130967 13:107036581-107036603 ACACAGAAATCATCTTTAAAAGG - Intergenic
1113315283 13:109173336-109173358 ACAGAGTAATCATTATTTATGGG - Intronic
1113673431 13:112190986-112191008 AAAGAGAGATAATAATTCATAGG - Intergenic
1113994651 14:16056194-16056216 ACTGGGAATTCCTCATTCATGGG - Intergenic
1115476108 14:33814415-33814437 TCAGAAACATCAGCATTCATAGG + Intergenic
1116410364 14:44613969-44613991 AGAGACAAATGATCATTCTTTGG - Intergenic
1117515421 14:56495806-56495828 ACAGAGAAAACTTCATTATTTGG + Intronic
1118042941 14:61937113-61937135 ACAGAGACATCACCATCCACGGG - Intergenic
1120195135 14:81473331-81473353 ACATACAAATCATCTTTCCTTGG + Exonic
1120323663 14:82998292-82998314 AAAGAGTAATCATGGTTCATGGG - Intergenic
1120718215 14:87863037-87863059 ACAGGGAAGGCATCATACATGGG + Intronic
1120845199 14:89119231-89119253 ACAGAGAATTCAGCATTGAGGGG - Intergenic
1121287058 14:92744220-92744242 ACAGAGAAAATATGATTCATTGG + Intronic
1123700943 15:22914406-22914428 AAAGAGAAATCATGTTTCCTGGG - Intronic
1126307476 15:47276898-47276920 AAAGAGCATTCATGATTCATGGG + Intronic
1126653099 15:50946709-50946731 ACTGAGAAAGCATCATTTATTGG - Intronic
1126841250 15:52719420-52719442 ACACAGAAATGAGCATTGATTGG + Intergenic
1126900415 15:53308975-53308997 GCTGAGAAATCCTCCTTCATAGG + Intergenic
1130037401 15:80374171-80374193 ACAGAGAAGACAACATTTATTGG + Exonic
1133059784 16:3166981-3167003 ACTGACAAATCATCTTTCTTAGG - Intergenic
1134504578 16:14794626-14794648 AAAGAGCAAACATCCTTCATGGG + Intronic
1134575993 16:15334283-15334305 AAAGAGCAAACATCCTTCATGGG - Intergenic
1134726450 16:16422218-16422240 AAAGAGCAAACATCCTTCATGGG + Intergenic
1134940981 16:18289641-18289663 AAAGAGCAAACATCCTTCATGGG - Intergenic
1135386575 16:22046657-22046679 ACAGTGAAATCATCAGTAAAAGG + Intronic
1137094278 16:36233740-36233762 CCAAAGAAATCATCATTGAATGG - Intergenic
1137448078 16:48544518-48544540 AAAGAGTAAACATCAGTCATGGG + Intronic
1138095903 16:54211377-54211399 ACAGAGCAATCAACAATCAATGG - Intergenic
1140914345 16:79481403-79481425 GCAGAGAAATCACTATTCATGGG - Intergenic
1144440762 17:15279232-15279254 ACTAAGAAATCATCTTTCCTTGG - Intergenic
1148682462 17:49482586-49482608 AAAGAGAAATGATGAGTCATTGG + Intergenic
1149181117 17:53937988-53938010 AAAGAGAAATTATCTTTCATAGG - Intergenic
1149729838 17:58934273-58934295 ACAGAGAAATAATCCCTTATTGG - Intronic
1150481967 17:65517681-65517703 ATTGAGAGATCATGATTCATTGG - Intergenic
1150992127 17:70271822-70271844 ACAGAGAAATAATAATTCTGTGG + Intergenic
1151451913 17:74203277-74203299 ACAGAAAATTCTTCATTCAATGG - Intergenic
1154052801 18:10977923-10977945 AATGAGAAATAATTATTCATGGG + Intronic
1155910756 18:31502140-31502162 AAAGAGATATGAGCATTCATTGG + Intronic
1156663552 18:39378116-39378138 ACACAGAAATCATTCTTCAGAGG - Intergenic
1157431262 18:47628776-47628798 ACAGAGAAATGATCATTTGGTGG + Intergenic
1157751034 18:50178685-50178707 CCAGACACATCATCATTCTTTGG + Intronic
1159573247 18:70144292-70144314 ACAGGGAAATCTTGAGTCATAGG - Intronic
1159886992 18:73918524-73918546 ACATTGAAATCATCTTGCATTGG + Intergenic
1160136048 18:76272728-76272750 AAAAAAAAATCATCAGTCATTGG + Intergenic
1164530670 19:29046067-29046089 ACAGAACAAGCCTCATTCATGGG + Intergenic
1164625577 19:29725446-29725468 ACTAAGAAATCATCACTAATTGG + Intergenic
1167427207 19:49435566-49435588 AGAGAGTCATCATCATACATGGG - Intronic
1167817759 19:51898932-51898954 AAAAAGAAATCATCAACCATTGG + Intronic
929323296 2:40573021-40573043 TAAGAGAAGTCATAATTCATGGG + Intronic
929590519 2:43142833-43142855 ACAAAGAAGTCAGTATTCATGGG - Intergenic
930461125 2:51677828-51677850 ACAAAGAAATGAGCAGTCATGGG - Intergenic
931034577 2:58224987-58225009 ACAAAGAAATCATGATTCTTTGG + Intronic
931318635 2:61155349-61155371 AAAGAGAAATAAAAATTCATTGG - Intronic
931811918 2:65862568-65862590 ACAGCCTAATCATCCTTCATGGG - Intergenic
931914536 2:66939042-66939064 ACAGAGTAAACATGAGTCATAGG + Intergenic
934624964 2:95838875-95838897 ACAGAGAATTTATCAAGCATGGG - Intronic
934808613 2:97262438-97262460 ACAGAGAATTTATCAAGCATGGG + Intronic
934828898 2:97494753-97494775 ACAGAGAATTTATCAAGCATGGG - Intronic
937092519 2:119215939-119215961 CCCCAGAAATCATCATTCCTGGG - Intergenic
937610146 2:123851433-123851455 AGAGAGAAATCATGATTGGTGGG - Intergenic
938470563 2:131556312-131556334 ACAGAGATATCATCTCACATCGG - Intergenic
938536818 2:132254560-132254582 ACTGGGAATTCCTCATTCATGGG + Intronic
940017813 2:149124981-149125003 ACAGAAAGATCATCCTTCAAAGG - Intronic
940608543 2:155960393-155960415 ACAGAGAAATCTTCCTTGAAAGG + Intergenic
940868774 2:158842414-158842436 ACAAATAAATCCTCCTTCATTGG - Intronic
942618057 2:177815207-177815229 ACTGAGAAATCACCATGGATTGG - Intronic
943110257 2:183595793-183595815 ATAGAGAAATGAGCATTTATTGG - Intergenic
943801630 2:192067112-192067134 ACAGAGAATGCATCATTACTTGG + Intronic
943985636 2:194614621-194614643 AAAGAGCATTCATAATTCATAGG - Intergenic
944892162 2:204128598-204128620 ACAGGGAAATCATAAGTCTTAGG + Intergenic
945947763 2:216010793-216010815 ACAGACAAATGATCAATGATCGG + Intronic
946685941 2:222270010-222270032 ACAAAGAAATCACCATGCAGTGG + Intronic
948188489 2:236040563-236040585 AAGAAGAAATCATCATGCATGGG - Intronic
948276394 2:236712290-236712312 ACAGAGAATTCACCTTTCATTGG + Intergenic
948395890 2:237644763-237644785 ACTGAGAAATCGTCATGGATTGG - Intronic
1168956374 20:1837186-1837208 ACGGAGAAATGCTCATTCCTTGG + Intergenic
1176875947 21:14128638-14128660 TCAAAGAAATCATCAATCTTAGG + Intronic
1178167844 21:30002314-30002336 ACAGAGAAATTATCCATCTTAGG - Intergenic
1178700635 21:34830701-34830723 ACAGAGAAATCGAAATTCAGAGG - Intronic
1180312441 22:11251215-11251237 ACTGGGAATTCCTCATTCATGGG + Intergenic
1183906252 22:41042681-41042703 ACATAGAAATGGTCATTCAGTGG - Intergenic
951920428 3:27848546-27848568 ACTTTGAAATCATCATTCCTTGG - Intergenic
952027805 3:29104310-29104332 CTATAGAAATTATCATTCATTGG - Intergenic
953690957 3:45118994-45119016 ACACAGAAACCATCCATCATAGG + Intronic
954933508 3:54305389-54305411 TTTGAGAAATCATCATTTATTGG + Intronic
954937386 3:54339091-54339113 ACAATGAAATCAGAATTCATTGG + Intronic
955659869 3:61286900-61286922 ATATAAAACTCATCATTCATTGG + Intergenic
955935673 3:64100214-64100236 ATAGAGGAAGCATCATACATAGG - Intronic
956970025 3:74512190-74512212 ACTGAGGAATCATAATTTATGGG + Intronic
958219205 3:90640768-90640790 ATAAAGAAATCATGATTCAAAGG + Intergenic
958219555 3:90647892-90647914 ATAAAGAAATCATGATTCAAAGG + Intergenic
959267405 3:104159961-104159983 ACTGGGAAAACATCACTCATTGG + Intergenic
959755981 3:109899885-109899907 ACAGAGAAATCATCAGCAAAAGG - Intergenic
959975667 3:112455788-112455810 AAACAGAAAGCATCATTAATTGG + Intergenic
961862968 3:129932406-129932428 TCTATGAAATCATCATTCATTGG - Intergenic
961933864 3:130562741-130562763 ACAGAGAAATAAAAAATCATGGG - Intronic
962786111 3:138769335-138769357 ATATAGGAAACATCATTCATTGG - Intronic
963565669 3:146927244-146927266 ACTGAGAAATCATGATACCTTGG - Intergenic
964799940 3:160545219-160545241 ACAGAAAAATCTTCATTGAAAGG + Intronic
964830542 3:160879326-160879348 ACAGAGGACTCTTCATTCCTGGG - Intronic
965668675 3:171123400-171123422 TCAGAGAAATCAGTATTCAGTGG - Intronic
966288249 3:178323247-178323269 AAAAAGAATTCATAATTCATAGG - Intergenic
967984005 3:195082011-195082033 AAAGAGACATCATCAATCGTTGG - Intronic
970264385 4:14265044-14265066 AGAGAGAGATCATCTTTCTTTGG + Intergenic
970790924 4:19856469-19856491 AAAGAGAGATCATCAATCAGAGG + Intergenic
970937587 4:21592449-21592471 AAACAGAAATTATCATTGATTGG + Intronic
971062322 4:22986138-22986160 ACAGAAACATCATCATTGATTGG - Intergenic
972206915 4:36785023-36785045 AGAGACTAATCAACATTCATTGG + Intergenic
972312900 4:37897869-37897891 AAAGAGAGATCATTATTTATGGG + Intronic
974523849 4:63021685-63021707 ACAGAAAAATAAACATTTATAGG - Intergenic
974554975 4:63434589-63434611 AAAGAAAAAGCATTATTCATGGG - Intergenic
975393293 4:73845890-73845912 AAAGAGAAACCTTCCTTCATGGG + Intronic
976307983 4:83580067-83580089 ACAGTCATATGATCATTCATTGG - Intronic
976997251 4:91450274-91450296 GCAGAGAATTATTCATTCATGGG + Intronic
977092730 4:92699497-92699519 ACAGAGTAATGATCATTAAATGG + Intronic
980913278 4:139012346-139012368 GCAGAGAAATCCTCAGTCCTGGG + Intergenic
981079561 4:140625120-140625142 GGAGAGAAATCAACATTCATTGG - Intronic
981651721 4:147067564-147067586 ACAGCCAAATCATCAGTAATAGG - Intergenic
982148782 4:152428630-152428652 ACAATGAAATCACAATTCATAGG + Intronic
982547330 4:156750547-156750569 AGAGAGAAGACATTATTCATTGG - Intergenic
982987282 4:162226460-162226482 ATAGGGAATTCATCAATCATAGG + Intergenic
983642752 4:169958346-169958368 AAAGAGAAATGATTCTTCATAGG + Intergenic
985061379 4:186082716-186082738 AAAGAAAAATCATCAATCTTGGG - Exonic
985997559 5:3605388-3605410 ACAGAGAAGTCACCAGGCATTGG - Intergenic
986342754 5:6805241-6805263 ACATTGAAACCATCATACATTGG - Intergenic
987858963 5:23459056-23459078 ACAGAGAAATTTTCTTTAATGGG - Intergenic
988632968 5:32951044-32951066 AAAGAGAAATTAGCATTCCTTGG + Intergenic
991495026 5:67218186-67218208 AAAGAGAAATGAAAATTCATTGG + Intergenic
992321416 5:75616735-75616757 AAAGAGAAAGCATATTTCATAGG - Intronic
993520950 5:88899397-88899419 ACAGAGGAAATATCTTTCATTGG + Intronic
993978890 5:94517221-94517243 ACAGAGAAATCTTCTTTTTTTGG + Intronic
994208468 5:97061918-97061940 ACAGAGAAATGATCAGTATTTGG - Intergenic
994525003 5:100895199-100895221 ACACAGAAATACTCATTCACAGG + Intronic
996146043 5:119977929-119977951 AAAGAGAAATTATCATCCATTGG - Intergenic
996382657 5:122877842-122877864 AGTGAGGAATCATCATTCATTGG - Intronic
1000081255 5:157849160-157849182 ACAGAGAAATCATCTGTGAAAGG + Intronic
1000182690 5:158827534-158827556 CCTGAGAAATCCTCATTGATGGG - Intronic
1000205515 5:159054309-159054331 TCAGAAAAATCATTATCCATGGG + Intronic
1000482494 5:161796603-161796625 ACAGCAAAATAATAATTCATTGG + Intergenic
1003217478 6:4127871-4127893 ACACAGGAATCATCAATCAATGG + Intronic
1003965003 6:11244338-11244360 AAAGGGAATTTATCATTCATAGG - Intronic
1004128037 6:12892843-12892865 CAAGAGATATCATCATTGATAGG + Intronic
1005454746 6:26008496-26008518 ACAGAGGAAACACCATTCTTTGG + Intergenic
1005488132 6:26320568-26320590 ACAGAGAAAAAATCATTTAAAGG - Intergenic
1005657632 6:27958047-27958069 AGAGAGAAACCATCTTTCCTTGG - Exonic
1006091160 6:31629754-31629776 AAGGAGGAATCATCATCCATCGG - Exonic
1006728927 6:36220808-36220830 ACTGAAAAATTATGATTCATTGG + Intronic
1007888161 6:45256363-45256385 ACAGAGAAATCATCATTCATGGG - Intronic
1007943310 6:45802374-45802396 AGAGACAAATCATCCTTCAGTGG - Intergenic
1010089033 6:71957432-71957454 ACAGAGAATTCATCAGCCTTGGG - Intronic
1010101285 6:72111250-72111272 ACAGAAAATTCAACATACATTGG - Intronic
1010218889 6:73430285-73430307 ACAAAGCCATCATTATTCATAGG + Intronic
1010958054 6:82114064-82114086 ATTGAGTAATCATCATTTATGGG + Intergenic
1013499315 6:110732115-110732137 ACAGAGAAATCATCACTAAAAGG + Intronic
1013661374 6:112300166-112300188 ACAGAAGAATCATGACTCATTGG + Intergenic
1013851605 6:114522588-114522610 ACAGAGAAAATGTCATTCTTGGG + Intergenic
1014513689 6:122356098-122356120 AGAGAAAACTCATAATTCATGGG + Intergenic
1015231689 6:130922033-130922055 ACATAGAAATGCACATTCATTGG - Intronic
1016124290 6:140380918-140380940 ACAGAGGAATCATGATACACGGG + Intergenic
1016877644 6:148879849-148879871 AGAGTGAAATCATGTTTCATGGG + Intronic
1017190163 6:151644869-151644891 TCAGCAAAATCATCATTCAAGGG - Intergenic
1017376036 6:153769320-153769342 ACAGTGAACTCATTAATCATGGG + Intergenic
1017457052 6:154610467-154610489 AGAGAGAATTCATCATTTTTTGG + Intergenic
1018133451 6:160754595-160754617 ACCCAGAAATCATAATCCATGGG + Intergenic
1018882240 6:167895954-167895976 GCAGTTACATCATCATTCATGGG + Intronic
1022034539 7:26521255-26521277 ACATAAAAATCATGGTTCATTGG + Intergenic
1022265658 7:28751866-28751888 ACTGAGAAATCGTCATGGATTGG - Intronic
1023715148 7:43036650-43036672 ACAGTGAAAGCATCACTTATAGG - Intergenic
1024142328 7:46474745-46474767 AGGGAGAAATCATCACTGATAGG + Intergenic
1024437026 7:49369213-49369235 ACAGTGAAATGATCATTTCTAGG - Intergenic
1024600969 7:50981338-50981360 ACAAAGAAATGTTCAATCATAGG - Intergenic
1027344184 7:77240234-77240256 ACAGAGAAAGGATCACTCAATGG - Intronic
1027401718 7:77815668-77815690 ATAGAGAAATAGTCACTCATTGG + Intronic
1031280962 7:119798409-119798431 GGAGAGAAATCATCTTTGATTGG - Intergenic
1032061147 7:128726422-128726444 AGAGAAAAATCATCACTCAGGGG - Intronic
1033473723 7:141670964-141670986 GCAGAAAACTCATCATTCCTTGG - Intronic
1033908112 7:146231597-146231619 ACAAAGAAAGAATCATTCACTGG - Intronic
1035671172 8:1418195-1418217 ACAGTTACATCATCATTCTTTGG - Intergenic
1035917320 8:3638769-3638791 AGAGAGAAACCAGCATGCATAGG + Intronic
1036234735 8:7028737-7028759 ACAGAGAAAGCATCAGGCATTGG + Intergenic
1036976006 8:13413461-13413483 ACAGAGAAATAATTTTGCATTGG - Intronic
1038295699 8:26289669-26289691 ACAGAGGAATGATCATGCAGTGG + Intergenic
1038987981 8:32834147-32834169 ACAGAGAAATCATCGCTGTTCGG - Intergenic
1040104293 8:43531975-43531997 ACAGAGTGATGATCATACATTGG + Intergenic
1040566424 8:48571772-48571794 ACAGAGAAAGCAGCTCTCATTGG + Intergenic
1041416343 8:57613223-57613245 ACAGTGAAAACATTATTCAAAGG + Intergenic
1041635411 8:60137471-60137493 CCAGAGACATCATCATCCACAGG + Intergenic
1042733654 8:71964033-71964055 ACAGATACCTCATAATTCATGGG + Intronic
1042935871 8:74057627-74057649 ACACAGAAATCATGATTGTTGGG + Intergenic
1043593427 8:81856152-81856174 ACAGAGAAAACCGCATTGATGGG - Intergenic
1043686745 8:83096089-83096111 AATGAGAAATCCTCATTCAAAGG + Intergenic
1044107605 8:88230832-88230854 ACAGAGAGATCATGAATAATGGG - Intronic
1044132414 8:88540889-88540911 ACAGAGAGATCATTCTTCAGTGG - Intergenic
1044404652 8:91814264-91814286 ACAGAGTAATCATAATTGGTTGG + Intergenic
1044751187 8:95417190-95417212 AAAGAAAAATCATCAGTAATGGG - Intergenic
1044895231 8:96884689-96884711 ACTGAGAACTGATCTTTCATAGG + Intronic
1045870805 8:106924809-106924831 ACAAAGGATCCATCATTCATTGG + Intergenic
1046154563 8:110270503-110270525 ACATAGAAATTATCATTGAATGG + Intergenic
1049928970 9:438023-438045 ACAGAAACATCATAATACATAGG + Intronic
1050493360 9:6213448-6213470 ACAGAGAAATCACTGTTGATCGG + Intergenic
1050524063 9:6530246-6530268 ACAGAGAAAGCCTATTTCATGGG + Intergenic
1051023962 9:12583070-12583092 ACAGATAAATCATAATTACTGGG + Intergenic
1051605397 9:18913232-18913254 ATGGAGAAATATTCATTCATGGG + Intergenic
1052210916 9:25902155-25902177 ACAGACAAATGATTACTCATTGG + Intergenic
1055756524 9:79564177-79564199 TCTGAGAAATTTTCATTCATGGG - Intergenic
1058798476 9:108521259-108521281 AGTGAGAAATCATCATGCAGTGG + Intergenic
1060335990 9:122723558-122723580 AAAGAGATAACTTCATTCATAGG + Intergenic
1061999952 9:134210913-134210935 ACATTGCAATCATCATTCATGGG + Intergenic
1186040093 X:5466489-5466511 TCAGGGAAATCTTCATTCATAGG - Intergenic
1186333971 X:8566567-8566589 ACAGTGATGTCATAATTCATAGG + Intronic
1186395613 X:9205894-9205916 ACAGAGAAAGGATGATCCATGGG + Intergenic
1187693748 X:21897715-21897737 GGAGAGAAATCATCAATCTTTGG + Intergenic
1188141981 X:26562083-26562105 ACAGTGAAAGCTTCATTCACAGG - Intergenic
1190976205 X:55403968-55403990 ACATAGAGATCACCATTCACAGG - Intergenic
1194381648 X:93199489-93199511 AAAGGGAAATAATCATTCAAGGG - Intergenic
1195020242 X:100819772-100819794 AAACAGAAAACGTCATTCATCGG - Intergenic
1198666874 X:139034228-139034250 ACTAAGTAATCACCATTCATTGG + Intronic
1201077515 Y:10198866-10198888 ACTGGGAATTCGTCATTCATGGG - Intergenic
1201246263 Y:12006773-12006795 ACAGATATATCATAATTCATAGG + Intergenic
1201546851 Y:15174867-15174889 TCAGAGAAACCTTCATTCATAGG + Intergenic