ID: 1007888165

View in Genome Browser
Species Human (GRCh38)
Location 6:45256382-45256404
Sequence CTGTTTCCTCACATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007888160_1007888165 -3 Left 1007888160 6:45256362-45256384 CCCCATGAATGATGATTTCTCTG 0: 1
1: 0
2: 2
3: 21
4: 249
Right 1007888165 6:45256382-45256404 CTGTTTCCTCACATGGAGGAAGG No data
1007888156_1007888165 30 Left 1007888156 6:45256329-45256351 CCAGTACATTCATTGATCTGGTG 0: 1
1: 0
2: 0
3: 8
4: 84
Right 1007888165 6:45256382-45256404 CTGTTTCCTCACATGGAGGAAGG No data
1007888159_1007888165 3 Left 1007888159 6:45256356-45256378 CCTATTCCCCATGAATGATGATT 0: 1
1: 0
2: 0
3: 22
4: 173
Right 1007888165 6:45256382-45256404 CTGTTTCCTCACATGGAGGAAGG No data
1007888162_1007888165 -5 Left 1007888162 6:45256364-45256386 CCATGAATGATGATTTCTCTGTT 0: 1
1: 0
2: 4
3: 23
4: 327
Right 1007888165 6:45256382-45256404 CTGTTTCCTCACATGGAGGAAGG No data
1007888161_1007888165 -4 Left 1007888161 6:45256363-45256385 CCCATGAATGATGATTTCTCTGT 0: 1
1: 0
2: 0
3: 19
4: 270
Right 1007888165 6:45256382-45256404 CTGTTTCCTCACATGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007888165 Original CRISPR CTGTTTCCTCACATGGAGGA AGG Intronic
No off target data available for this crispr