ID: 1007896482

View in Genome Browser
Species Human (GRCh38)
Location 6:45366554-45366576
Sequence AGTTTTTAGCAGATAAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 245}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007896482_1007896485 20 Left 1007896482 6:45366554-45366576 CCCTCCTTTATCTGCTAAAAACT 0: 1
1: 0
2: 2
3: 25
4: 245
Right 1007896485 6:45366597-45366619 TTACCCTTTTTTTCACAATCAGG 0: 1
1: 0
2: 1
3: 25
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007896482 Original CRISPR AGTTTTTAGCAGATAAAGGA GGG (reversed) Intronic
901282968 1:8053529-8053551 AGTTTTGAGCAGATTACTGAAGG - Intergenic
907083360 1:51645233-51645255 AGTGTTAAGAAAATAAAGGAAGG - Intronic
907644402 1:56227500-56227522 AGATTCTAGAAGAAAAAGGAAGG + Intergenic
907725983 1:57021199-57021221 AAATTTTAGCAGCTAAAGAAAGG + Intronic
908402342 1:63783188-63783210 TGTTTTTAGCATATGAAGGGTGG + Intronic
910364599 1:86451091-86451113 AGTTATTAGCAGTTGAAAGAAGG + Intronic
910418308 1:87025925-87025947 AGTTTCTTGCAGTTAAAGCAGGG + Intronic
911146916 1:94561425-94561447 AGTTTTGAGCAGAGAAGTGATGG - Intergenic
911552860 1:99305783-99305805 CATTTTTAGCAGATAAAAGTCGG - Exonic
911681905 1:100726518-100726540 AGATTTTGCCAGATGAAGGAAGG - Intronic
912194389 1:107380242-107380264 AATTTTTGGCAAATAAAGCAAGG + Intronic
913115532 1:115692811-115692833 GGTTTGTTGCAGATACAGGAAGG - Exonic
916429411 1:164712716-164712738 AGGTCTTAGGAGACAAAGGAAGG + Intronic
918820288 1:189245467-189245489 TGGTTTTAACAGATAAATGAGGG + Intergenic
1063777305 10:9278583-9278605 AGCTTTTAGCAAATGAAGGAAGG + Intergenic
1064368468 10:14729508-14729530 AGTATGGAGCAGATAAAGGGAGG + Intronic
1064727271 10:18293444-18293466 AGTATTAATCAGATGAAGGAGGG - Intronic
1065746394 10:28846215-28846237 AGTTTTTGTCAGAACAAGGAGGG + Intergenic
1066015363 10:31237074-31237096 AGTTTTTACCAGAGCAATGAAGG + Intergenic
1066432734 10:35368443-35368465 ACTTGGTAGCAGATAAAGAATGG - Intronic
1067072282 10:43142086-43142108 ATTTTTTAGAAGTTAAAGCAGGG + Intronic
1068665237 10:59667853-59667875 AGTTTTTACCATTTAAAGAAAGG - Intronic
1071411235 10:85399035-85399057 AGTTATGAGCACATAAAGAAAGG - Intergenic
1074121255 10:110496068-110496090 ATTTATTAGCAGATTAAGCAGGG - Intergenic
1074789116 10:116868459-116868481 AGTTTGTGGCATATAAAGTAGGG + Intronic
1076106473 10:127827475-127827497 AGTTTTCTGCAGATTCAGGAGGG + Intergenic
1076463551 10:130662651-130662673 AGTTTTTCTCAGAAAAATGATGG + Intergenic
1078389752 11:10926689-10926711 AGTTTATAGAAGATGAGGGATGG + Intergenic
1078533844 11:12157399-12157421 AATTTTTAGCAGCTAGAGGCAGG + Intronic
1079307459 11:19336002-19336024 AGATTACTGCAGATAAAGGAAGG + Intergenic
1079632150 11:22691095-22691117 AGTTTGAAGCAGATGAAGGAGGG + Intronic
1083438434 11:62659509-62659531 GGGTTTTAGTAGATACAGGATGG - Intronic
1084024433 11:66438957-66438979 TGTTTTATGCAGATAAAGGAAGG + Intronic
1085138577 11:74118584-74118606 AGTTCAAAGCAAATAAAGGAAGG + Intronic
1085962612 11:81480469-81480491 AGTGTTTAGCAGATTTAGTAAGG - Intergenic
1087510576 11:99087324-99087346 AATTTATACCAGATAAAGTAGGG - Intronic
1088201543 11:107340870-107340892 AGTTTTTAGCATACAAAATATGG + Intronic
1088503443 11:110507036-110507058 AGAACTTATCAGATAAAGGAGGG - Intergenic
1090889751 11:130913475-130913497 TGTGTTGAGCAGATCAAGGAAGG + Intronic
1091771970 12:3157987-3158009 TTTTTTTAGTAGATAAAGGGAGG - Intronic
1093408130 12:18831254-18831276 AGTATGTAGAAGATGAAGGAAGG - Intergenic
1094235730 12:28163646-28163668 AGTTTTCAGAAGAAAAAGGGTGG + Intronic
1097826221 12:64177208-64177230 AGTTTATAGAACAGAAAGGAAGG + Intergenic
1099569313 12:84295595-84295617 AGCTTTTTGAAGATAAAGAATGG - Intergenic
1099921206 12:88959247-88959269 AGCTTTTACAAGAAAAAGGAGGG - Intergenic
1099994674 12:89765260-89765282 AGTTTCTAGCGGCTAAAGGAAGG - Intergenic
1100104236 12:91148961-91148983 AGTGATTAGCAAGTAAAGGAAGG + Intronic
1102286700 12:111663495-111663517 AATTTTTTGCAGAGAAAGGCAGG - Intronic
1102821488 12:115912813-115912835 AGTTTTCACAAGAGAAAGGAAGG - Intergenic
1108387551 13:49914015-49914037 TGTTTCTAGTTGATAAAGGAGGG + Exonic
1108559021 13:51625010-51625032 AGTTTTGAGCAGATCAAGATTGG + Intronic
1110163140 13:72403407-72403429 AGTTTTGCAAAGATAAAGGAAGG - Intergenic
1110326827 13:74226073-74226095 AATTTTAAGCAGATAAATGGTGG + Intergenic
1110417086 13:75264808-75264830 AGGTTTTAACATATAAATGATGG + Intergenic
1111926298 13:94466859-94466881 ACCTTTTAAGAGATAAAGGAGGG - Intronic
1112197218 13:97237787-97237809 ATTTTTAAGCAGGTAAATGAGGG + Intronic
1116213537 14:41978859-41978881 AGTTATCAGCAGATAAATTAAGG + Intergenic
1116720620 14:48490878-48490900 AAATTTTACAAGATAAAGGATGG + Intergenic
1120072105 14:80115259-80115281 AGTATTAACTAGATAAAGGAAGG - Intergenic
1121156864 14:91693868-91693890 GCTTTTAAGCAGATAAAGGGAGG - Intronic
1121184426 14:91954087-91954109 AGATTTTAGCAGGTTAAGGTGGG - Intergenic
1125499048 15:40226162-40226184 AGTTTTTACAACATAGAGGAGGG - Intergenic
1126229720 15:46310605-46310627 AGATTTTAGAAGATGAAGTAAGG + Intergenic
1127197099 15:56599415-56599437 TATATTTATCAGATAAAGGATGG + Intergenic
1127859481 15:62981159-62981181 AGCTTCTAGCTGATAAAGGAAGG - Intergenic
1128333261 15:66770147-66770169 AGTTTGTAGCAGATGATGGTAGG - Intronic
1129984221 15:79902742-79902764 AAATTATAGCAGATAAAGGATGG + Intronic
1129991264 15:79965470-79965492 AAATTCTAGCAGATAAAGGATGG + Intronic
1130337085 15:82965783-82965805 ATTTTCCAGCAGATAAAAGAGGG + Intronic
1133290476 16:4717390-4717412 TGTTTTTAGTAGATACAGGCTGG - Intronic
1135164493 16:20126656-20126678 ATTTTTTAGGAGATCATGGAAGG + Intergenic
1135920972 16:26648772-26648794 ATTTTGAGGCAGATAAAGGAGGG - Intergenic
1136748673 16:32614218-32614240 AGTTTTCAGCACAGAAATGAGGG - Intergenic
1137372126 16:47917230-47917252 ATTTATTAGCAGAGAAAGAATGG + Intergenic
1139308115 16:66005402-66005424 AGCTTTCAGCATATAAAGGTGGG - Intergenic
1140520541 16:75577214-75577236 AGGTTTCAGGAGAAAAAGGATGG - Intronic
1142052661 16:87969193-87969215 TGTTTTTAGCAGCAAAAGAATGG - Intronic
1203050806 16_KI270728v1_random:873432-873454 AGTTTTCAGCACAGAAATGAGGG - Intergenic
1143195845 17:5075853-5075875 AGTTTTGAGCAGAGTGAGGAAGG + Intergenic
1144112713 17:12052036-12052058 AGTTTTGAGGAGGAAAAGGAAGG - Intronic
1146150048 17:30459931-30459953 AGTTCTTAGTAAATAAAGGAGGG - Intronic
1149330604 17:55577330-55577352 AGGTTTCAGCAGAGAAATGAAGG - Intergenic
1152055155 17:78018881-78018903 AGTTTTAAGCAGTTACAAGAGGG + Intronic
1155187054 18:23396219-23396241 AGGTCTTGTCAGATAAAGGAGGG + Intronic
1155481035 18:26287867-26287889 ACTCTTGAGCAGATAAATGATGG + Intronic
1155657565 18:28209695-28209717 ACTTATTAGCAGAAAAAGGTGGG - Intergenic
1156849547 18:41710499-41710521 AGTTGTTTGCAGGTAAAGCAAGG - Intergenic
1156917535 18:42479384-42479406 AGATTTTAGTAGATAAAGAAAGG + Intergenic
1157647596 18:49292410-49292432 ACTGTTTACCAGAAAAAGGAAGG - Intronic
1158391736 18:57050376-57050398 AGTTTGGAGCAGCTGAAGGAAGG - Intergenic
1159419898 18:68204775-68204797 TGTTTTTATCAGCTATAGGAGGG - Intergenic
1162632963 19:11943314-11943336 ACTTGCTAGCAGCTAAAGGAGGG - Intronic
1163764411 19:19154741-19154763 GGTTTTAAGCAGAGAAGGGATGG + Intronic
1164237523 19:23350124-23350146 ACTTATTAGCAGAAAAAGGTGGG + Intronic
1167417716 19:49385757-49385779 AGTTTTTAGAAGGCAAATGATGG + Intergenic
1167803714 19:51764152-51764174 TGTTTTTGGCAGAAAATGGAAGG + Intronic
1168266771 19:55227713-55227735 AGTTCTGAGCAGAGCAAGGATGG - Intronic
927155923 2:20221524-20221546 ATTTTTTGGTTGATAAAGGAAGG + Intronic
927665617 2:25030387-25030409 AGTATTTAGCATACTAAGGAAGG - Intergenic
928805180 2:35141254-35141276 AGTTTTTTACAGATGATGGAAGG - Intergenic
929444158 2:41989763-41989785 AGTTCTAAGCAGAGAGAGGAAGG + Intergenic
930165274 2:48197954-48197976 TGTTGTTAGCAGAGAAGGGAGGG + Intergenic
930211588 2:48644295-48644317 AGTTTTTAGGATAAAAAGTAGGG + Intronic
932428805 2:71660810-71660832 AGTCTTTAGCAGCTAAAGAAGGG - Intronic
932668349 2:73716141-73716163 TTTTTTTAACAAATAAAGGAGGG + Intergenic
933452000 2:82466569-82466591 AGTTGCTAGCAGAGAAAAGATGG + Intergenic
933496632 2:83058043-83058065 ATTTTATAACAGATAAAGGGAGG + Intergenic
934025908 2:88001369-88001391 AATTCTTAGCTGATAAAAGACGG + Intergenic
935386819 2:102508434-102508456 ACATTTTAGAAGTTAAAGGATGG - Intronic
935721091 2:105979975-105979997 ACTTGCTAGCAGCTAAAGGAGGG - Intergenic
936436803 2:112514945-112514967 AGGTTTTAATAGATAAAGAAAGG - Intronic
937664090 2:124464359-124464381 AATTTTTTGCAGAAAAAAGAAGG + Intronic
937674372 2:124573212-124573234 ACTTCTTATCAGAGAAAGGAAGG + Intronic
940178276 2:150903589-150903611 AGTTTTTATCAATTTAAGGATGG + Intergenic
940432466 2:153609469-153609491 ACTTTTAAGCAGAGAAATGATGG - Intergenic
942695037 2:178632630-178632652 AGATTTGAGCTTATAAAGGATGG - Exonic
942751218 2:179289550-179289572 AGTTTTTAGTTTATATAGGATGG + Intergenic
943454889 2:188093389-188093411 ATTATTAAGTAGATAAAGGAGGG + Intergenic
943657945 2:190529220-190529242 GGTTTTAAGCAGGTAAATGATGG - Intronic
943904104 2:193475741-193475763 ATCTTTTAGCAGAAAAAGGAGGG + Intergenic
945289945 2:208116987-208117009 ACTTGCTAGCAGCTAAAGGAGGG + Intergenic
945529619 2:210935049-210935071 GTTTTTTCTCAGATAAAGGAAGG - Intergenic
946816835 2:223587536-223587558 TATTAATAGCAGATAAAGGAGGG + Intergenic
947288781 2:228547723-228547745 AGATTTTAGCAGCTAGAGCAGGG - Intergenic
947453830 2:230234692-230234714 AATTTTTATAAGATAAAGGAGGG - Intronic
948433397 2:237935174-237935196 AGTTTTTTGCAGAGATGGGAGGG - Intergenic
948948505 2:241234122-241234144 CATTATTAGCAGATAATGGAAGG - Intronic
1169033802 20:2433318-2433340 AATCTTAAGAAGATAAAGGAAGG + Intergenic
1171012203 20:21514916-21514938 AGTCTTTAGCAAATAAAGGGCGG - Intergenic
1172551973 20:35808165-35808187 AGTTGTTTGCAGATACATGATGG - Intronic
1176104416 20:63379160-63379182 ATTTTTGAGCAGATGAAGAAAGG - Intergenic
1176344546 21:5730008-5730030 AGTTTTAACAAGATAAAGGCTGG - Intergenic
1176351360 21:5850592-5850614 AGTTTTAACAAGATAAAGGCTGG - Intergenic
1176500281 21:7594447-7594469 AGTTTTAACAAGATAAAGGCTGG + Intergenic
1176538867 21:8128078-8128100 AGTTTTAACAAGATAAAGGCTGG - Intergenic
1176557818 21:8311123-8311145 AGTTTTAACAAGATAAAGGCTGG - Intergenic
1176665176 21:9679559-9679581 GCTTTTAAGCAGATAAAGGAAGG - Intergenic
1177016003 21:15788063-15788085 AATTTTGAGAAGATAAAGCAAGG + Intronic
1177017676 21:15812980-15813002 AGGTTTTAGATGAAAAAGGAAGG - Intronic
1177031718 21:15988495-15988517 ACTCTTTATCTGATAAAGGATGG - Intergenic
1178211055 21:30532487-30532509 AGTTTCTAATAGATAAAGAATGG - Intergenic
1179483463 21:41693476-41693498 GTTTTTAATCAGATAAAGGAAGG + Intergenic
1182441758 22:30368721-30368743 AGCTTTTTGCAGATGCAGGAGGG - Intronic
1183125316 22:35773907-35773929 AGTTTCTAGCAGAGAATGCAAGG + Intronic
1183313997 22:37127348-37127370 AGTTTCTGGCAGATTAAGGGAGG + Exonic
1183656901 22:39191250-39191272 AGTTTATATAAAATAAAGGAGGG + Intergenic
1183917995 22:41138607-41138629 AGTTTTTGTCAGATGAAGGAGGG + Intronic
1184899307 22:47434393-47434415 AGTTTTCTGAAGATAGAGGAAGG - Intergenic
1184970769 22:48018417-48018439 AATTTTTACCAAATAAATGATGG - Intergenic
1203243816 22_KI270733v1_random:44433-44455 AGTTTTAACAAGATAAAGGCTGG - Intergenic
949306948 3:2652451-2652473 AGTGTTCAGCAGATAATGAAAGG + Intronic
949667110 3:6352428-6352450 AGTTTTTAGTAGATAAGTGTTGG + Intergenic
949835529 3:8265499-8265521 AGTTTTTAAAAGTGAAAGGAAGG + Intergenic
951834279 3:26963824-26963846 AGTATTTTGCAGGGAAAGGATGG - Intergenic
952032591 3:29162201-29162223 AGTATTTAGTAAATAAATGAAGG - Intergenic
953696535 3:45164413-45164435 TGTTTATAGCAGAGAAGGGAAGG - Intergenic
957244447 3:77700495-77700517 AGTTTCTAGGAGAGAAAGGATGG + Intergenic
957603003 3:82362356-82362378 AGTTTAGAGGAGAAAAAGGATGG + Intergenic
957801634 3:85091813-85091835 AATTTTTAGCTGATAAAATATGG + Intronic
963515151 3:146300220-146300242 AGCTTTTAGTAGAAAAAGGTTGG - Intergenic
964987173 3:162757931-162757953 AGTTTGTTGCAGATCAAAGATGG + Intergenic
965956809 3:174379982-174380004 GATTTTAAGCAGAAAAAGGAAGG + Intergenic
966986115 3:185181826-185181848 AGTGTTTAGCAGGGAAAGGCAGG - Intergenic
967700091 3:192582326-192582348 AGTTGTTAGCCTATAAAGGAGGG + Intronic
971854093 4:32022081-32022103 AGGTTTTAGCAGACCAAAGAAGG - Intergenic
972179705 4:36448604-36448626 AGATGTTGGGAGATAAAGGAGGG + Intergenic
974441153 4:61919521-61919543 AGTTTTTTTCAGATAAAGAATGG + Intronic
974694873 4:65353808-65353830 AGTGTGTAGCAGAGAGAGGAAGG - Intronic
977053464 4:92160005-92160027 AGTTTTCAACAGATAAAACATGG - Intergenic
978228620 4:106369592-106369614 TGTGTTTATCAGATGAAGGAAGG - Intergenic
979374888 4:119934586-119934608 AGATTTTAGAAGTTAAAAGATGG + Intergenic
979910061 4:126353648-126353670 AGTTTTTAACATAAGAAGGAAGG + Intergenic
982587333 4:157258908-157258930 AAATTGTAGAAGATAAAGGAAGG + Intronic
983107416 4:163705806-163705828 AGTTTTTAGCAAATATAACAAGG + Intronic
984613234 4:181865460-181865482 ACTTTTTAGCAGAAAACTGAAGG - Intergenic
985410656 4:189680027-189680049 GCTTTTAAGCAGATAGAGGAAGG - Intergenic
987068478 5:14312972-14312994 TGATTTAAGCACATAAAGGATGG - Intronic
988032093 5:25775957-25775979 AGTCTTTAGAAAATAAAAGATGG + Intergenic
988191150 5:27936768-27936790 AATTTTTTGCAGAATAAGGATGG - Intergenic
988653017 5:33174489-33174511 AGCCTGTAGCAGATAATGGAGGG - Intergenic
988735498 5:34016488-34016510 AGTTGTTAGCAGTTTATGGATGG - Intronic
989505246 5:42218997-42219019 AGGTTTTGGCAGATACAGGATGG + Intergenic
993425909 5:87764068-87764090 AGTTTTTAGGAGATAGCAGAAGG - Intergenic
993515839 5:88834022-88834044 AGTTTTGCACAGATAAAGGGAGG - Intronic
994537594 5:101050601-101050623 ATTTGCTTGCAGATAAAGGATGG + Intergenic
995644522 5:114296191-114296213 AGTTTTTCTAAGTTAAAGGAGGG + Intergenic
996442125 5:123503258-123503280 AGTTGTAAGCAGCTAAAGGTTGG + Intergenic
998954736 5:147427494-147427516 AGTTTTGAGAAAATAAATGATGG + Intronic
999551390 5:152691039-152691061 AGTGTGTAGAAGATTAAGGAAGG - Intergenic
1000473803 5:161679574-161679596 AGTTATTAGTAGACAAAGCAAGG + Intronic
1000841238 5:166220988-166221010 AATTGTTTGCAGATAAAGGAAGG - Intergenic
1003215089 6:4101984-4102006 ACTTTTTAGCATAAAAAAGAAGG + Intronic
1003466138 6:6381941-6381963 TGTTTTAAGGAGATAAAAGAAGG + Intergenic
1004576806 6:16904109-16904131 ACTTTTCAGCAGAGAAAGAAAGG + Intergenic
1005127591 6:22465948-22465970 TGTTTTTAGCAGGTCAAGAATGG + Intergenic
1005149593 6:22733829-22733851 AGTCTTTAGCAGGAAAAGGTAGG - Intergenic
1005174437 6:23028487-23028509 TGTTTTCAGCCTATAAAGGATGG + Intergenic
1005562054 6:27050377-27050399 AGTTTTCAGCAGATGAGGGATGG - Intergenic
1005902174 6:30226406-30226428 AGTTTTTGGCAAATGAAGCATGG + Intergenic
1007896482 6:45366554-45366576 AGTTTTTAGCAGATAAAGGAGGG - Intronic
1008068421 6:47074858-47074880 TGTTTTTAAAAGATGAAGGAGGG + Intergenic
1008372730 6:50753300-50753322 TGTTTTGAGCATAAAAAGGATGG - Intronic
1008619355 6:53256735-53256757 AGTTTTTATAAGACCAAGGATGG - Intergenic
1010496858 6:76543894-76543916 AGTTTTTATCACATAATAGATGG + Intergenic
1011784985 6:90833522-90833544 AGTCTTTAGGAGATCAGGGAGGG + Intergenic
1014243805 6:119046054-119046076 AGTTGTAATAAGATAAAGGATGG - Intronic
1014273435 6:119360519-119360541 AGGTCTTAGCAGAAAAAGTACGG + Intergenic
1014596137 6:123342233-123342255 ATTTCTTATCAAATAAAGGAGGG - Intronic
1014627630 6:123748539-123748561 AGTTTATAGCATTTAAAGTAAGG + Intergenic
1014912987 6:127116471-127116493 ACTTTGCAACAGATAAAGGATGG + Intergenic
1014971030 6:127815582-127815604 AATTTTTAGAAAAAAAAGGAGGG + Intronic
1018827296 6:167418528-167418550 ACTTTTTAGCAAATAAAAAATGG - Intergenic
1019049870 6:169174791-169174813 AGTTTTTAGCTGATGGAAGAAGG - Intergenic
1021055683 7:16043353-16043375 AATTTTGAGCAGATAAAGTGTGG - Intergenic
1021956529 7:25830545-25830567 AGTTTTAAGAAGATAGAGGGAGG - Intergenic
1023072793 7:36454037-36454059 AGTCTTTAGCAGATACTGAATGG + Intergenic
1024746561 7:52413705-52413727 AGTATTTAGCTGATATAGGCAGG - Intergenic
1027898559 7:84078487-84078509 AGTATTTAGAAGATAAATGCAGG - Intronic
1027940223 7:84669055-84669077 TGTTCTTAGCAAATAAAGGAGGG - Intergenic
1028454059 7:91019112-91019134 AGTTTTTAGCAGACAGAGCCTGG + Intronic
1030765867 7:113409078-113409100 CGTTTTTAGCAAAAGAAGGATGG - Intergenic
1032590803 7:133190569-133190591 AGCTCTGAGCAGAGAAAGGAGGG + Intergenic
1032634438 7:133691008-133691030 GCTTTTAAGCAGATAAGGGAGGG + Intronic
1034303357 7:150034242-150034264 GGTTTTTAGTTGCTAAAGGATGG - Intergenic
1034456235 7:151172352-151172374 AGTTTTTTGCTGGTAAAGAAAGG - Intronic
1037212357 8:16406343-16406365 AGTTTTTAAAAGAAAAAGAAAGG - Intronic
1038109578 8:24480539-24480561 AGAATTTAGCAGATAAAGCATGG + Intronic
1040497193 8:47976621-47976643 TGTTTCTAACAGGTAAAGGAGGG + Intronic
1041703128 8:60814248-60814270 AGTTTATAGCAGATAAAGCAGGG + Intronic
1043010339 8:74873206-74873228 ATCTTTTATCAGATTAAGGAAGG - Intergenic
1044620715 8:94188374-94188396 AATTTTTGGCAGTTAATGGAAGG + Intronic
1045237039 8:100361281-100361303 AGGGTTCAGCAGAAAAAGGAAGG + Intronic
1045513925 8:102840138-102840160 ACTTTTTGGCAGTTGAAGGAAGG + Intronic
1046323801 8:112614084-112614106 ACTTTTTAGCAGAGAACTGAAGG + Intronic
1046541135 8:115585437-115585459 AATTTTAAGTAGAAAAAGGAAGG + Intronic
1046994161 8:120497147-120497169 AGTTGATAACAGATAAAGGCAGG - Intronic
1047784412 8:128139726-128139748 TTGTTTTAGCAGATAAAGTAGGG - Intergenic
1048664415 8:136644625-136644647 AGTTATTAGTAGATAGAGCAAGG + Intergenic
1049987357 9:964026-964048 AGTGTTTAACATATAGAGGAAGG + Intronic
1050264600 9:3876786-3876808 AGTTTGTAACATATAAAGAATGG - Intronic
1050886371 9:10771666-10771688 AGGTTTTAGCAGGTGAAGGAAGG - Intergenic
1051486397 9:17613333-17613355 AGTTTTCAGCAGAGCATGGATGG - Intronic
1052158488 9:25225939-25225961 ATTTTTTGTCAGATAAATGAAGG - Intergenic
1054829074 9:69603493-69603515 AGTTTATAACAGAAAAAGCAGGG - Intronic
1055362562 9:75509214-75509236 AGATTTCAGCAGGGAAAGGAAGG + Intergenic
1055421479 9:76147976-76147998 AATTTTTAGCTGTGAAAGGAGGG - Intronic
1057978161 9:99629041-99629063 AGTTGCTACCAAATAAAGGATGG + Intergenic
1058125438 9:101188703-101188725 AATTTTTAACCAATAAAGGAAGG - Intronic
1058493973 9:105534124-105534146 ATTTTTTTGCAGTTAAATGAAGG - Intronic
1058920330 9:109608372-109608394 AGCTTTTAGCTGATTAAGAAAGG + Intergenic
1059622328 9:116020572-116020594 CGTTTTTAAAAGATAAAGCAAGG - Intergenic
1203460146 Un_GL000220v1:27515-27537 AGTTTTAACAAGATAAAGGCTGG - Intergenic
1203660924 Un_KI270753v1:42190-42212 GCTTTTAAGCAGATAAAGGAAGG + Intergenic
1203672106 Un_KI270755v1:25399-25421 GCTTTTAAGCAGATAGAGGAAGG + Intergenic
1186869036 X:13751535-13751557 AGTTTTTAAAAGATAAGGGCCGG + Intronic
1188225907 X:27597224-27597246 ACTTTTTAGCAGATATAGGAAGG + Intronic
1189153717 X:38733765-38733787 AGTTTAGATCAAATAAAGGAAGG + Intergenic
1190279716 X:48921758-48921780 AGGTTTTAGAAGGTGAAGGACGG - Intergenic
1190857405 X:54310228-54310250 ATTTTGTAGAAGATAATGGAAGG - Intronic
1191136371 X:57069422-57069444 ATATTTTACCAGATAAAGAAAGG + Intergenic
1192355855 X:70402824-70402846 AGAGTTTAGTAGATAAAGGTTGG + Intronic
1192461632 X:71322018-71322040 AGTTTTTAGAAGTAGAAGGAGGG + Intergenic
1193344797 X:80392893-80392915 AGTTTTTATCATGTAAATGATGG - Intronic
1193841277 X:86411708-86411730 TGTTTTTAGCAAAATAAGGAGGG + Intronic
1194374357 X:93113339-93113361 ATTGGTTAGCAGATATAGGATGG - Intergenic
1195363111 X:104104218-104104240 AGTTTATAGATGCTAAAGGATGG + Exonic
1195409493 X:104554553-104554575 ACTTTGTCGCAGATACAGGATGG + Intergenic
1196180277 X:112681926-112681948 AGTGTTTGGCAAATGAAGGATGG - Intergenic
1196337484 X:114554514-114554536 AGTTTCCAGCAGATAGAGAAGGG - Intergenic
1196608978 X:117689084-117689106 AGTTGTAACCAGAAAAAGGAAGG - Intergenic
1196798019 X:119517949-119517971 AAATTTTAGGACATAAAGGATGG + Intergenic
1197318228 X:124994873-124994895 AGTTTCAAGCAGAGAAATGATGG - Intergenic
1200682387 Y:6227407-6227429 ATTGGTTAGCAGATATAGGATGG - Intergenic