ID: 1007896674

View in Genome Browser
Species Human (GRCh38)
Location 6:45369176-45369198
Sequence TGTGGTAGAAAAGGAGGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 588
Summary {0: 1, 1: 0, 2: 5, 3: 44, 4: 538}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007896674 Original CRISPR TGTGGTAGAAAAGGAGGCTG GGG (reversed) Intronic
900191445 1:1353930-1353952 TGTGGGAGGAGAGGAGGCTGAGG + Exonic
900742527 1:4339408-4339430 GGTGGAGGAAGAGGAGGCTGCGG + Intergenic
900851489 1:5146393-5146415 TGTGGTGGACAAGGTGGATGTGG - Intergenic
901490793 1:9595336-9595358 TGTGAGAGCCAAGGAGGCTGAGG - Intronic
901884741 1:12215037-12215059 AGTGGCAGGAAATGAGGCTGAGG + Intergenic
901929444 1:12587589-12587611 TGTGGTGGCTTAGGAGGCTGAGG + Intronic
903126601 1:21252521-21252543 TGGGGTAGAAAATGGGGCTCAGG + Intronic
903884966 1:26535792-26535814 TGTGGCAGAGAAGGAAACTGAGG - Intronic
904422284 1:30402078-30402100 TGTGGTAGAGGAGGAGGCAGTGG - Intergenic
904929234 1:34073142-34073164 TGTGGTTAATAAGGAGGCAGAGG - Intronic
904964092 1:34358359-34358381 GGAGGAAGAAGAGGAGGCTGTGG + Intergenic
905916433 1:41687723-41687745 TTTGGTAGATAAGCAGGGTGAGG - Intronic
906090657 1:43176774-43176796 AGTTGTAGATAGGGAGGCTGGGG + Intronic
906225585 1:44118928-44118950 TGAGATGGAACAGGAGGCTGGGG + Exonic
906473864 1:46153786-46153808 TGTGGTAAATAAGGAGTTTGTGG - Intronic
906665768 1:47620948-47620970 TGGGGTAGAAGAGGAGGGGGAGG + Intergenic
906696247 1:47825335-47825357 TGTGGAGGATAAGGAGGCAGTGG - Intronic
907026043 1:51120171-51120193 AGTGGTGGAAAAAGACGCTGGGG + Intronic
907280543 1:53344279-53344301 TCTGGTAGAGCAGAAGGCTGTGG - Intergenic
908657868 1:66406906-66406928 GGTGGTGGAATTGGAGGCTGTGG - Intergenic
908685689 1:66716857-66716879 TGTGGAAGCAAATGAGGCTTGGG - Intronic
909722049 1:78784398-78784420 TGTGGTAGAGAAGGACTCTTTGG - Intergenic
910078664 1:83312289-83312311 TTTGATAGAAAAGGAAACTGAGG - Intergenic
910356214 1:86359370-86359392 TGAGGTAGGAATGGAGGTTGTGG - Intronic
911170949 1:94770464-94770486 TGTGGCAAAAAAGGACCCTGGGG + Intergenic
912541798 1:110421853-110421875 TATGGCAGAAAAGAAGACTGGGG + Intergenic
912565192 1:110582479-110582501 TTTGGCAGAAGAGGATGCTGAGG - Intergenic
912609527 1:111029117-111029139 CAGGGTAGAAAAGGAGACTGTGG - Intergenic
912915426 1:113810312-113810334 TATTGTAGAAAAGGAAACTGAGG - Intronic
913478700 1:119263880-119263902 TATGATAGAAGGGGAGGCTGGGG - Intergenic
913594449 1:120359920-120359942 TGCGGTGGAAAAGGAGGCCTGGG - Intergenic
914305715 1:146414809-146414831 TGCGGTGGAAAAGGAGGCCTGGG - Intergenic
914829555 1:151160738-151160760 TTTGGCAGACAAGGAGGCTGGGG + Exonic
915068236 1:153244186-153244208 GGTGGTAGAAATGGAGGTGGTGG + Intergenic
915117386 1:153609287-153609309 GGTGGCAGGACAGGAGGCTGTGG - Exonic
915180416 1:154054153-154054175 TGTGGGAGATAGGGAGGCAGTGG - Intronic
915487833 1:156234343-156234365 TGTGGGAGAAAGGGTGGGTGGGG + Intronic
915569006 1:156733877-156733899 TGTGGGAGATAAGGTGGGTGCGG - Intronic
916575059 1:166059763-166059785 TCTGGTTGAAAATGTGGCTGAGG + Intronic
917800284 1:178563445-178563467 AGAGGCAGAAAAGGAGACTGTGG + Intergenic
918384013 1:183986781-183986803 TGTTATAGAAAAGAAGGCTGAGG + Intronic
919857470 1:201715542-201715564 TGGGTTAGAGAATGAGGCTGGGG + Intronic
920328816 1:205189649-205189671 TGTGGAAGAGAAGGATGCTTGGG - Intronic
920371610 1:205482570-205482592 TGTGACAGAAAAGGAACCTGGGG - Intergenic
920737193 1:208543381-208543403 TGTGGTAGAGGAGGTGGATGTGG + Intergenic
921035200 1:211371098-211371120 TGTGGTAGGAGAGGAGGAGGAGG + Intronic
921067212 1:211631524-211631546 GGAGGTAGAAGATGAGGCTGGGG - Intergenic
921874328 1:220176986-220177008 TCTGTGTGAAAAGGAGGCTGGGG - Intronic
923112829 1:230905928-230905950 TTTAGGACAAAAGGAGGCTGTGG + Intergenic
923776039 1:236979325-236979347 TTTGGTAGAGAGGGAGACTGAGG + Intergenic
923848293 1:237762590-237762612 TGACGAAGGAAAGGAGGCTGAGG - Intronic
924354904 1:243162274-243162296 TACGGTAGAAAAACAGGCTGGGG + Intronic
924410375 1:243798325-243798347 TGTGGGAGATCAGGAGGCTGAGG - Intronic
924437123 1:244051247-244051269 TGTGTTAGAATAAAAGGCTGAGG - Intronic
924541536 1:244985402-244985424 TGTGGTGGTAAAGGATGTTGTGG + Intronic
1063016997 10:2088265-2088287 TGTGTTAGGATAGGAGACTGTGG + Intergenic
1063205229 10:3825108-3825130 TCTAGTAGAAATGGAGGATGAGG + Intergenic
1063209703 10:3868886-3868908 TGTGGCAGAATGGGAGGCTAAGG - Intergenic
1063216036 10:3926445-3926467 TGTGGTAGACAAAGAGGCATTGG + Intergenic
1063592139 10:7405725-7405747 TTTTGTAGATAAGGAGGTTGAGG + Intronic
1064068365 10:12203234-12203256 TGTGGAAGTAATGGAGGATGAGG - Intronic
1064264577 10:13814973-13814995 TGTGGCAGAAATGGAGGCTTGGG + Intronic
1064792878 10:18978692-18978714 TGTGCTAAAAAAGGAAGCTTAGG + Intergenic
1065109145 10:22423133-22423155 TGTGGTGGGAAAGAATGCTGGGG + Intronic
1065608077 10:27441780-27441802 TGTGAAGGAAAAGGATGCTGGGG - Intergenic
1065866408 10:29919011-29919033 TGAGGAAGAAAAGGAGGAGGAGG - Intergenic
1067018679 10:42776280-42776302 CGTGGCAGAAATGGAGGCAGAGG - Intergenic
1067156879 10:43789639-43789661 TTTGGTGGAAGAGGAGGCTATGG - Intergenic
1067197357 10:44133595-44133617 TCTGGTAGATAAGGAGACTTAGG + Intergenic
1068119210 10:52769085-52769107 TTTGGTAGAAATGGAGGCAAAGG - Intronic
1069090344 10:64192883-64192905 AGTGGTAGTTTAGGAGGCTGGGG + Intergenic
1069321575 10:67178118-67178140 GGTGGGAGAACAGGTGGCTGAGG - Intronic
1070731405 10:78831136-78831158 TGTGGTTGAAAAGGAAGGAGCGG + Intergenic
1070918894 10:80171799-80171821 TGTGCTAGCAAAGGTGGCAGTGG + Intronic
1071286870 10:84156927-84156949 TGAGGCAGAACAGGATGCTGAGG - Intergenic
1072473235 10:95733709-95733731 TTTGGTAGTAATGGAGGATGGGG + Intronic
1073219515 10:101858562-101858584 TGGGGTTGAAAGGGAAGCTGTGG - Intronic
1073334754 10:102698000-102698022 TTTGCTATAAAGGGAGGCTGAGG + Intronic
1073638192 10:105220729-105220751 TGGGGAAGAGAAAGAGGCTGTGG - Intronic
1076440656 10:130479235-130479257 TGTGGGAGGAAAAGAGGATGAGG + Intergenic
1077317821 11:1927178-1927200 TGAAGCAGAAAAGCAGGCTGAGG + Intronic
1077435368 11:2536367-2536389 TATGGAAGGAAGGGAGGCTGGGG + Intronic
1078911447 11:15736485-15736507 TGTGGAAGAAAAGGTGGCATGGG - Intergenic
1079056100 11:17207857-17207879 TGTGGTAGAGGCGGAGGCTCAGG - Intronic
1079078492 11:17397841-17397863 TGAGGTAGAACAGGGGCCTGTGG - Intronic
1081686967 11:45049586-45049608 TCTTGTAGAAAAGGAGGGGGAGG + Intergenic
1081937863 11:46917653-46917675 GGTGGTTGGAAAGGGGGCTGAGG - Intronic
1083412260 11:62502184-62502206 TGGGGTGGGAAAGGAGGCAGAGG - Intronic
1083479041 11:62932025-62932047 AGTGGTAGGAAACGAGGCTCAGG - Intergenic
1084022854 11:66428223-66428245 TTTGGAATAAAAGGAGGCTTAGG - Intergenic
1084042431 11:66550019-66550041 TGAGGAAGGAAAGGTGGCTGAGG + Intronic
1084618611 11:70252989-70253011 TGTGTTCGGAAAGGAAGCTGTGG - Intergenic
1085197869 11:74683303-74683325 TGTGAGAGAAAGGGAAGCTGAGG + Intergenic
1085218367 11:74851757-74851779 AGTGGTAGAAACTGAGGCTCAGG - Intronic
1085389555 11:76175567-76175589 TGGGGTGGAAAATGAGGCTGGGG - Intergenic
1085709790 11:78818924-78818946 TGTGATAGAAAAACAAGCTGGGG - Intronic
1087124335 11:94608152-94608174 AGTGGGAGAGAGGGAGGCTGAGG - Intronic
1087480383 11:98692993-98693015 TGGAGTAGAAAAGGAATCTGGGG + Intergenic
1087879814 11:103402874-103402896 TGTGGTAAAAAAGTGGGCTAAGG + Intronic
1087985941 11:104679664-104679686 TATTTTAGAAAAGTAGGCTGTGG + Intergenic
1087997408 11:104826648-104826670 TGGGGAAGAAAAGGAGCTTGGGG - Intergenic
1088190555 11:107223490-107223512 TGTGATAGAGAATGTGGCTGTGG - Intergenic
1088227282 11:107635141-107635163 TGTGGAAGAGAATGAGGATGAGG - Intronic
1088280233 11:108127688-108127710 TGAGATAGTAAAGGAGACTGAGG + Intronic
1089242047 11:117089930-117089952 CGTGGTAGACAAGGAGCCTCTGG - Intronic
1089778185 11:120853995-120854017 TGTGGTAGAAGAGCAAACTGAGG - Intronic
1090028210 11:123185512-123185534 TGGAGCAGAGAAGGAGGCTGCGG + Intronic
1091366561 11:135026108-135026130 TGTGGTGGAGAAGGAGGTAGGGG + Intergenic
1091410954 12:239054-239076 CGTGGTAGAGCAGGTGGCTGAGG - Intronic
1091795081 12:3293532-3293554 GGTGGTGGGAAAGCAGGCTGGGG + Intergenic
1092388906 12:8057893-8057915 TGTGGAAGATTTGGAGGCTGGGG + Intergenic
1092458166 12:8663228-8663250 TATGGAATATAAGGAGGCTGAGG - Intergenic
1093145719 12:15564131-15564153 TGTGGAAGACAAAGAGGATGAGG + Intronic
1093229610 12:16527606-16527628 TGTCTTATAAAAGGAGTCTGAGG + Intronic
1094063956 12:26343652-26343674 TGGGGTAGATGAGGAGGCTGTGG + Intronic
1094606669 12:31955404-31955426 GGTGGTAGTAGAAGAGGCTGTGG + Intergenic
1094751973 12:33420394-33420416 TGTAGAAGACTAGGAGGCTGAGG + Intronic
1094827928 12:34286880-34286902 TGTGGTAGAGAAGGGGGCCCTGG + Intergenic
1096448081 12:51712858-51712880 TTTGGTGGAAGAGGAGGCTATGG - Intronic
1097348070 12:58517209-58517231 TGTGGTAGAGAAAGAAGGTGAGG + Intergenic
1098574996 12:72031014-72031036 TGTGGGAGAAAATGAGATTGTGG - Intronic
1099336518 12:81366296-81366318 TGTGGTAGAAGAGGAAACTAAGG - Intronic
1099615685 12:84932584-84932606 TGTGTTAGAAAAGAACTCTGTGG + Intergenic
1100429558 12:94518393-94518415 AGTGGTGGAAGAGGAGGTTGAGG - Intergenic
1101041873 12:100763605-100763627 TGGGGGAGATAAGGAGGCTCTGG - Intronic
1101227389 12:102703172-102703194 TGAGGTTGACAAGGAGGCAGTGG - Intergenic
1101721842 12:107357288-107357310 TTGGGTAGAGAAGGATGCTGAGG - Intronic
1101852913 12:108418582-108418604 TTTGGTAGAGAAGGATGCTGGGG - Intergenic
1102983122 12:117258177-117258199 TTTGATAGAAAAGGAAACTGAGG + Intronic
1103261556 12:119593494-119593516 TCTGGAATAAAAGGAGGCTCAGG - Exonic
1103649878 12:122423559-122423581 TGTGGTGGATAAGGGGGCAGGGG + Intergenic
1103923844 12:124413093-124413115 TGGGATTGAAATGGAGGCTGTGG - Intronic
1104590305 12:130079411-130079433 TGAGGTTGGAAGGGAGGCTGGGG + Intergenic
1104642118 12:130474196-130474218 TGTGACGGATAAGGAGGCTGAGG - Intronic
1105004610 12:132713588-132713610 AGTGGCGGAAAAGGAAGCTGTGG - Intronic
1105064652 12:133185805-133185827 TGTGGTAGAAATGGAGACACTGG + Intronic
1105295433 13:19085177-19085199 TGTGGTAGGGAAGGGGCCTGTGG - Intergenic
1105813421 13:24013139-24013161 AGTGGGAGAAGAGGAGGCTGAGG - Intronic
1106428182 13:29653911-29653933 AGTGGTGGGAAAGGAGACTGAGG + Intergenic
1106604358 13:31213760-31213782 TGAGGTGGATAAGGAGGGTGTGG + Intronic
1107333322 13:39325651-39325673 TTTGGTAGAAACCAAGGCTGAGG - Intergenic
1107412114 13:40167466-40167488 TATGGAAGAAAAGGAGCTTGGGG - Intergenic
1107725241 13:43292715-43292737 TATGGTGGTGAAGGAGGCTGTGG - Intronic
1109683964 13:65788323-65788345 TTTGGTGGAAGAGGAGGCTATGG - Intergenic
1110183530 13:72645638-72645660 TGTGGTTGAAGAGATGGCTGTGG - Intergenic
1110956976 13:81565207-81565229 TTTGGTAGATGAGGAAGCTGAGG - Intergenic
1111336137 13:86826122-86826144 TGTGATAGAAAATCAGGCTGAGG + Intergenic
1111506660 13:89198630-89198652 AGAAATAGAAAAGGAGGCTGAGG + Intergenic
1111933804 13:94538496-94538518 TGTGGTATAAAAGGAGGCAGGGG - Intergenic
1112827088 13:103404179-103404201 TGTGGTAAAAAAGAAGGCTGAGG - Intergenic
1113035029 13:106038872-106038894 TGTGGCAGCAAGGAAGGCTGGGG + Intergenic
1113095527 13:106660080-106660102 TGTTATAGATAAGGAGACTGAGG + Intergenic
1114271837 14:21104915-21104937 GGTGGTAGATGAGGAAGCTGAGG + Intergenic
1114548538 14:23520336-23520358 GGGGGAAGAAAAGGAGACTGGGG + Intergenic
1114791593 14:25665642-25665664 TGAGGCTGAAATGGAGGCTGTGG + Intergenic
1115546458 14:34468776-34468798 TGTGGTAGAAACCAAGACTGTGG - Intergenic
1116040741 14:39683727-39683749 TGTGGTTGAATAGGAAGTTGTGG + Intergenic
1116224958 14:42138546-42138568 TGTTGTAGAAATGAAGGCTAGGG - Intergenic
1116984648 14:51205811-51205833 TGTGGCAGGCAAGAAGGCTGTGG + Intergenic
1117342908 14:54807045-54807067 TGTGGTGCAAAAGGGGGCTTGGG - Intergenic
1117386814 14:55222990-55223012 TGTGCTAGATAAGAAGGCTAAGG + Intergenic
1118307908 14:64670731-64670753 TGTTGTAGACAAGGAAACTGAGG + Intergenic
1118709884 14:68510363-68510385 GGAGGTAGAGTAGGAGGCTGGGG + Intronic
1118869372 14:69728180-69728202 TGTGGTTGGAAGGGAGGGTGTGG + Intronic
1118946457 14:70392404-70392426 TTTTGTAGAAAAGGAAGCTGAGG - Intronic
1120656542 14:87197102-87197124 TGTGGTAGAGATGGAGCCTGGGG + Intergenic
1121242838 14:92442329-92442351 TGTGGTAGAGTAGGGTGCTGAGG + Intronic
1121696967 14:95921453-95921475 ATTGGTAGAAAAGAAGGCTTTGG + Intergenic
1121837105 14:97102079-97102101 AGTTGTAGAAAAGGATGCTTGGG - Intergenic
1122011882 14:98757126-98757148 TGTTGTAGAAACTGAGGCTCAGG + Intergenic
1122292382 14:100686800-100686822 TGTGGCAGCAGAGGGGGCTGAGG - Intergenic
1122398402 14:101451478-101451500 AGTAGTAGGAAAGGTGGCTGAGG - Intergenic
1122579475 14:102762448-102762470 GGGGGTAGAATAGGAGGATGGGG + Intergenic
1122789333 14:104177726-104177748 TGTGGTGGAAAAGGGCGGTGCGG - Exonic
1123650009 15:22470098-22470120 TGGGGGAGAAAAGTAGGGTGGGG + Intergenic
1123728422 15:23126176-23126198 TGGGGGAGAAAAGTAGGGTGGGG - Intergenic
1123740412 15:23278917-23278939 TGGGGGAGAAAAGTAGGGTGGGG + Intergenic
1123746586 15:23323641-23323663 TGGGGGAGAAAAGTAGGGTGGGG - Intergenic
1123803007 15:23841040-23841062 TGTTTTAGAAAAAAAGGCTGAGG - Intergenic
1124161706 15:27276164-27276186 TGTGGTAGAAGGGAAGGCTTTGG + Intronic
1124338145 15:28872708-28872730 GGTGGCAGAGAAGGAGGCTATGG - Intergenic
1124356997 15:29003064-29003086 TGAGGTAGAAGAGGTGGCAGAGG + Intronic
1125006550 15:34823671-34823693 TGAGGTAGACAATGAGGATGTGG - Intergenic
1125547276 15:40515288-40515310 GGAGGAAGAAAAGGAGGGTGGGG - Intergenic
1125739154 15:41949793-41949815 TTTTTTAGAAAAGGAGACTGAGG + Intronic
1127374513 15:58370797-58370819 TGTAGAAGAAAATGAGTCTGCGG + Intronic
1127928560 15:63572901-63572923 TGTTGTAGATGAGGACGCTGAGG - Intronic
1128216809 15:65940094-65940116 TGGGGCATAAAATGAGGCTGTGG + Intronic
1128751893 15:70155918-70155940 GGTGGTTGAAGTGGAGGCTGGGG + Intergenic
1129243372 15:74265108-74265130 TGGGGTGGAGAAGGAAGCTGAGG - Intronic
1129262045 15:74374073-74374095 TTTGTCAGATAAGGAGGCTGAGG + Intergenic
1129550530 15:76444086-76444108 TGTGGTGGAAAAGGACCCTCTGG - Intronic
1129600207 15:76994369-76994391 TGTGGCAGATGAGGAAGCTGAGG + Intronic
1130023234 15:80248535-80248557 AGTTGTAGAAAAGGATTCTGAGG + Intergenic
1130048672 15:80465431-80465453 GGAGGTAGAAATGGAAGCTGAGG + Intronic
1131230097 15:90653437-90653459 TTTGATAGATAAGGAGACTGAGG + Intergenic
1132259817 15:100413447-100413469 TGTGATAGAAAAGCAGGCAAAGG + Intronic
1132272282 15:100537039-100537061 GGTGGTAGAATAGGAGGAAGAGG - Intronic
1133177076 16:4023567-4023589 TGTGGCATGAGAGGAGGCTGGGG + Intronic
1133776869 16:8903576-8903598 TTATTTAGAAAAGGAGGCTGTGG + Intronic
1133875020 16:9725856-9725878 TGTTGTAGAAGGCGAGGCTGGGG - Intergenic
1134070535 16:11256943-11256965 TGCGGAAGAAACTGAGGCTGGGG + Intronic
1134245788 16:12538910-12538932 AGTGGGAGAAAGGGTGGCTGTGG + Intronic
1134630188 16:15750620-15750642 TTTTGTAGAAAGGGAGACTGAGG - Intronic
1135133307 16:19870132-19870154 CCAGGAAGAAAAGGAGGCTGGGG - Intronic
1135170417 16:20178751-20178773 TGTAGTAGAGAAGGGGGCTCTGG - Intergenic
1135630569 16:24033020-24033042 TGTGGTAGGAAAGGCAGGTGGGG + Intronic
1135632731 16:24048780-24048802 GGTTTTAGAAAAGGTGGCTGTGG - Intronic
1135758567 16:25118229-25118251 TGTGGTATGAAGTGAGGCTGGGG - Intronic
1135959229 16:26982014-26982036 TGTGGTAGGAGGGGAGACTGTGG - Intergenic
1136128209 16:28200785-28200807 TGAGGAAGATAAGGACGCTGAGG - Intronic
1136624968 16:31456816-31456838 ACTGGCAGAAAAGGAGCCTGGGG + Intergenic
1137852942 16:51764346-51764368 GGTGATAGAAAAGGAAGCTGTGG - Intergenic
1138117841 16:54374444-54374466 TGTGGTGGGAATGGGGGCTGGGG + Intergenic
1138563439 16:57815820-57815842 AGTGGCAGGAAAGGAGTCTGGGG - Intronic
1138633614 16:58319335-58319357 GGTGGCAGACAAGGAGGCTGGGG - Intronic
1138778799 16:59757325-59757347 CGTGGCAGAAAAGGATGTTGTGG - Intergenic
1139898501 16:70308367-70308389 TGTGGTGGCGCAGGAGGCTGAGG - Intronic
1140125988 16:72119490-72119512 GGTGGCAGGAAAGGCGGCTGTGG + Intronic
1140254099 16:73320054-73320076 TGAGGGAGAAAAGGAGGAGGAGG + Intergenic
1140818383 16:78641093-78641115 TTTGGGAGAGAAGCAGGCTGTGG + Intronic
1140849131 16:78918105-78918127 GGTGGGAGGATAGGAGGCTGAGG + Intronic
1140891162 16:79286360-79286382 TCTGCTAGAGAAGGAAGCTGAGG + Intergenic
1140893581 16:79305897-79305919 GGTGGCAGAAAAGCATGCTGTGG - Intergenic
1141792608 16:86246783-86246805 TGTGGCAGGACAGGAGCCTGTGG - Intergenic
1142996476 17:3763661-3763683 TGTGTCAGGAAAGGTGGCTGGGG + Intronic
1143332634 17:6148895-6148917 GGAGTTAGAGAAGGAGGCTGGGG - Intergenic
1143594625 17:7906951-7906973 TTTGGTAGGAGAGGAGGCTCTGG - Exonic
1143618876 17:8069793-8069815 TGTGTTTGGGAAGGAGGCTGGGG - Intergenic
1144016400 17:11200443-11200465 TTTGTTAGAAAAGGAGGGGGAGG + Intergenic
1146279696 17:31537180-31537202 CGATGTAGAAAAGGAGGCAGTGG - Exonic
1146439302 17:32879718-32879740 TGTGAAAGACAAAGAGGCTGAGG + Intergenic
1146468893 17:33108784-33108806 TTTTCCAGAAAAGGAGGCTGAGG - Intronic
1146930199 17:36771620-36771642 GGTGGATGAAAATGAGGCTGGGG + Intergenic
1147334173 17:39716754-39716776 AGTGGCAGAAAAGGGGCCTGGGG + Intronic
1150191373 17:63244085-63244107 TGTGGTGGAAAAGGATTCTCTGG + Intronic
1150440436 17:65186989-65187011 TCAGGTAGAAAAGGACCCTGGGG - Intronic
1150555570 17:66251034-66251056 TGTGGAAGAAAAGGAGGGTCAGG - Intronic
1150850472 17:68699204-68699226 GGTGGGAGAAGTGGAGGCTGGGG + Intergenic
1152616442 17:81340080-81340102 TGGGGTAGAAGAGGAGGCTGAGG - Intergenic
1153757332 18:8297703-8297725 TGTTGTAGAAAAAGAAACTGGGG + Intronic
1154076784 18:11211133-11211155 TCTGGTAGAAAAGGAGCATATGG - Intergenic
1156263981 18:35469413-35469435 TGTGGCTGAGGAGGAGGCTGAGG - Intronic
1156287295 18:35709817-35709839 TGTGGCAGAAATGTATGCTGAGG - Exonic
1156882342 18:42095470-42095492 TCCTGTAGAAAAGGAGGGTGGGG - Intergenic
1157029462 18:43887790-43887812 TTTGATAGAAAAGGATTCTGAGG - Intergenic
1157187395 18:45552359-45552381 TGGGGGAGAGAAGGAGCCTGGGG - Intronic
1157529085 18:48407316-48407338 TGTGTTACAAAAGGAGTTTGAGG + Intronic
1158055107 18:53269698-53269720 TTTGGTAGACAAGGAAACTGAGG + Intronic
1158076846 18:53540172-53540194 TGTATTAGAAAAGGAGGAGGAGG - Intergenic
1158631078 18:59114531-59114553 TGTGGTAGAAGAGAAGACAGTGG - Intergenic
1159009419 18:63044204-63044226 TTTGGTAGAAGAGGAGACTGAGG + Intergenic
1159102553 18:63971676-63971698 TTTGGTATGAAAAGAGGCTGGGG - Intronic
1161095487 19:2388044-2388066 TGTGACAGAAAAAGAGTCTGTGG + Intergenic
1161699643 19:5787718-5787740 AGTGGCAGAACAGGAGGGTGAGG + Intronic
1161838613 19:6665012-6665034 TGTGGTACACCTGGAGGCTGGGG - Exonic
1161840074 19:6674765-6674787 TGTCTTAGGAAAAGAGGCTGTGG + Intergenic
1162766883 19:12925047-12925069 TATGGAAGGGAAGGAGGCTGGGG - Intronic
1163263900 19:16206927-16206949 TGTGGCAGAGTATGAGGCTGAGG + Intronic
1164578646 19:29420838-29420860 TGTGGGTGGAGAGGAGGCTGGGG - Intergenic
1164618415 19:29680155-29680177 TCAGGTAGAAAATGGGGCTGGGG + Intergenic
1165157122 19:33795710-33795732 AGTGGGAGAAAAGGAGGAAGGGG + Intergenic
1165421474 19:35724104-35724126 TCTGATAGAGAAGGTGGCTGAGG + Intronic
1165855633 19:38878112-38878134 CGTGGCAGGAGAGGAGGCTGTGG + Intronic
1166405969 19:42522137-42522159 TGTGGAGGACAAGGATGCTGTGG - Exonic
1167006927 19:46782357-46782379 GGTGGTGGGAGAGGAGGCTGGGG - Intronic
1167637846 19:50665893-50665915 TGTGGTGGCATGGGAGGCTGAGG + Intronic
1168103130 19:54151666-54151688 TGTAATAGGAAACGAGGCTGTGG + Intronic
925603139 2:5629274-5629296 TGCGGTGGAAAAGGAGGCCTGGG - Intergenic
925765233 2:7227520-7227542 TGAGGCAGAAAAGAAGACTGAGG + Intergenic
926345227 2:11938610-11938632 TGTGTTAGAAGAGGAGGCCTGGG + Intergenic
926449044 2:12980109-12980131 TATGGAAGAAAAGGAATCTGAGG - Intergenic
927075194 2:19570679-19570701 TATGCTAGAAAACAAGGCTGAGG + Intergenic
927101252 2:19789317-19789339 TGGGGTAGGAAGGCAGGCTGGGG + Intergenic
927325893 2:21804637-21804659 GTTAATAGAAAAGGAGGCTGTGG - Intergenic
927519474 2:23690300-23690322 TTTTGCAGAAGAGGAGGCTGAGG + Intronic
927989638 2:27438657-27438679 GGAGGTAGAAAAGGAGGCGGTGG + Intronic
929831577 2:45351027-45351049 AGTGGGAGAAAAGAAGGCAGAGG - Intergenic
929982808 2:46697868-46697890 GGTGTTAGAAAAGTGGGCTGAGG + Intergenic
930767409 2:55097993-55098015 TGAGGTAGAAAAAGAGATTGGGG - Intronic
930863841 2:56103839-56103861 TGGGGTTGAAAAGGAGGCTGGGG - Intergenic
931156038 2:59631426-59631448 TGGGGGAGAAAAGTAAGCTGAGG - Intergenic
931317170 2:61143866-61143888 TCTTGGAGAAAAGGATGCTGCGG - Intergenic
931610271 2:64091282-64091304 TGTGGTAGCACAGCAGGGTGTGG + Intergenic
931836821 2:66107962-66107984 TGTGGTAGAAATAGAGGGTCTGG - Intergenic
932141145 2:69279179-69279201 GCTGTTAGAAAAGGAGGCGGAGG - Intergenic
932682380 2:73836851-73836873 TGGGGAAGAAATGGAGGCTTAGG + Intronic
932809007 2:74808225-74808247 TGGGGTAGAAAGGAAGCCTGTGG - Intergenic
933723639 2:85413875-85413897 TGTGGGAGAAGAGGAGGGAGCGG + Intronic
933741661 2:85538864-85538886 TGTGGGAGAAAAAGCGACTGGGG - Intergenic
933808226 2:86015536-86015558 TTTTATAGAAGAGGAGGCTGGGG + Intergenic
934603930 2:95679958-95679980 GGGGCCAGAAAAGGAGGCTGTGG + Intergenic
934765530 2:96878164-96878186 TGAGGAGGAAAAGGAGGATGGGG + Intronic
936238719 2:110768930-110768952 TGGGGCAGAAAAGGGGCCTGAGG - Intronic
936321991 2:111474965-111474987 TGCGGTGGAGCAGGAGGCTGGGG - Intergenic
937152383 2:119694859-119694881 TGTGGCATATAAGCAGGCTGGGG - Intergenic
937169476 2:119851310-119851332 TATGGTAGAAAAAGAGACTGAGG + Intronic
937499491 2:122462639-122462661 TGAGGCAGAAAAAGAGACTGAGG - Intergenic
938547437 2:132347526-132347548 TCTGGGAGAAAAGAAGGCCGCGG - Intergenic
938907761 2:135854787-135854809 TGTGTTAGCCCAGGAGGCTGAGG + Intronic
940117532 2:150225494-150225516 TAAGGTAGAAAAAGAGACTGAGG + Intergenic
940366836 2:152857725-152857747 TGTGGAGGGAAAGGAGGGTGAGG + Intergenic
941225180 2:162838999-162839021 AGAGAGAGAAAAGGAGGCTGGGG + Intergenic
942447790 2:176089705-176089727 TCTGGAAGAAAAGGAGGAAGAGG + Intergenic
942862260 2:180629089-180629111 TGTGGAAGAGAATGAGGTTGAGG - Intergenic
945964808 2:216175295-216175317 TTTGGTGGAAGAGGAGGCTCTGG - Intronic
946101397 2:217327762-217327784 TGTGCCAGCAAAGAAGGCTGGGG - Intronic
946238769 2:218341465-218341487 TGTGGTAAAGAAGGGGGCTTAGG + Intronic
946968848 2:225069369-225069391 TCTTGCAGAGAAGGAGGCTGTGG - Intergenic
947298741 2:228664404-228664426 GGTGGAAGAAAGGGAGGATGTGG + Intergenic
947303826 2:228721007-228721029 AGTAGTAGAAAAGAGGGCTGGGG + Intergenic
947324094 2:228955820-228955842 TTTCAGAGAAAAGGAGGCTGAGG + Intronic
947612240 2:231531301-231531323 TGTGGGGGAGCAGGAGGCTGTGG - Intergenic
947699282 2:232218920-232218942 GGTGGCAGGAGAGGAGGCTGAGG - Intronic
948103144 2:235391337-235391359 GGAGGTAGAGAGGGAGGCTGGGG - Intergenic
948341063 2:237252491-237252513 TGTGGTAGAAGTGGATGCAGAGG + Intergenic
948850577 2:240703550-240703572 TGGGGTGGAAAAGCAGGCAGAGG + Intergenic
1168980103 20:1996752-1996774 TGTGTGTGTAAAGGAGGCTGCGG - Intergenic
1169256313 20:4102560-4102582 TGTGTTTGGAAGGGAGGCTGGGG + Intergenic
1169443141 20:5649679-5649701 TGTATTAGAAAATGAGGCCGTGG + Intergenic
1169951031 20:11043372-11043394 TGTAGAAGAAAAGGAGGGTGTGG + Intergenic
1170767332 20:19301457-19301479 TGTGGTAGAAGAGCACTCTGTGG - Intronic
1170953291 20:20955938-20955960 CCTGGTAGACCAGGAGGCTGGGG - Intergenic
1172979417 20:38929520-38929542 AGTGGTAGGAGAGGAAGCTGGGG + Intronic
1173340159 20:42146131-42146153 TGGGATAGAAGAGGAGGCTAGGG - Intronic
1173829498 20:46072078-46072100 TGTGGTTGGAAGGGAGGATGAGG - Intronic
1175263641 20:57689789-57689811 TGTCGTAAAAAGAGAGGCTGTGG + Intronic
1175388867 20:58614003-58614025 TGTGGAAGGACAGGAGGCAGTGG - Intergenic
1175422310 20:58842012-58842034 AGTCGTCGAAAAGGAGGCAGGGG + Intronic
1175886092 20:62291802-62291824 TGTGGTAGCCACGCAGGCTGGGG + Intronic
1176059836 20:63167731-63167753 TGTGGTGTGAGAGGAGGCTGGGG - Intergenic
1176197291 20:63843414-63843436 GGTGGGAGAGACGGAGGCTGCGG - Intergenic
1177209295 21:18050222-18050244 ACTGGAAGAAAGGGAGGCTGAGG + Intronic
1177734049 21:25066286-25066308 TGTGGTTGTAAAGGAGGCACTGG + Intergenic
1177809225 21:25906926-25906948 TGTGGTTTAAATGCAGGCTGAGG + Intronic
1177820084 21:26021927-26021949 TGAGGTAGAGGAAGAGGCTGAGG - Exonic
1177872352 21:26589027-26589049 TGTGTTAGAAATGAAGGATGGGG - Intergenic
1178857372 21:36261601-36261623 TGTTGCAGAAAATGAGGGTGAGG + Intronic
1179071582 21:38076245-38076267 TGTAGTAGGAAGGGAAGCTGGGG + Intronic
1180799276 22:18624273-18624295 CATGGCAGAAAAGGACGCTGAGG + Intergenic
1180880996 22:19203551-19203573 GGTGGGAGAAAAGCAGGCAGGGG - Intronic
1180919894 22:19516248-19516270 GCTGGTAGACAAGGAGGCTCGGG + Intronic
1181054053 22:20251436-20251458 TGTGAAGGAAAAGTAGGCTGTGG + Intronic
1181164730 22:20977183-20977205 TGTGGTGGAAACTGAGGCTCTGG - Intronic
1181185819 22:21102976-21102998 TGGGGCAGAAAAGGTGGTTGGGG - Intergenic
1181222442 22:21370993-21371015 CATGGCAGAAAAGGACGCTGAGG - Intergenic
1181480579 22:23196567-23196589 TGGTGTCAAAAAGGAGGCTGGGG - Intronic
1181634589 22:24168746-24168768 TGTTACAGAAAAGGTGGCTGAGG - Intronic
1181932769 22:26416029-26416051 TTTGGTGGATAAGGAGGCTGAGG + Intergenic
1182104827 22:27681824-27681846 TGGGGTAGAAAGTGAGGGTGGGG + Intergenic
1182118114 22:27769401-27769423 TGGGAGAGAACAGGAGGCTGGGG - Intronic
1182181580 22:28354977-28354999 TGTGGTAGTAAAGTGGGGTGGGG - Intronic
1182547882 22:31086058-31086080 TGTGGTACATTTGGAGGCTGGGG - Intronic
1182651429 22:31854404-31854426 TGTGATAGAAAGAGAGACTGTGG + Intronic
1183777302 22:39974933-39974955 GGAGGCAGAAGAGGAGGCTGAGG - Intergenic
1183834052 22:40437399-40437421 TGAGGCAGAAAAGGAAGCTGGGG - Intronic
1184653735 22:45931007-45931029 TCTGCTAGAAGAGGAGCCTGAGG + Intronic
949581378 3:5391906-5391928 GGTGGGAGAAAAGATGGCTGGGG + Intergenic
949599165 3:5579755-5579777 TCTTGTAGAACAGGAGCCTGTGG + Intergenic
949602860 3:5620075-5620097 AGAGGTAGAAATGGATGCTGGGG - Intergenic
950667924 3:14508457-14508479 GGTGGAGGAAAAGGAGGCAGAGG + Intronic
952651673 3:35735231-35735253 TGTGGTTCCACAGGAGGCTGAGG - Intronic
952882363 3:37992731-37992753 TGTGGGAGCGGAGGAGGCTGTGG - Intronic
952969692 3:38643180-38643202 TGTGGGGTACAAGGAGGCTGAGG - Intronic
953043651 3:39276897-39276919 TGTGGGAGAGGAAGAGGCTGTGG + Intronic
953911761 3:46896747-46896769 TGTGGAAGATACAGAGGCTGGGG + Intronic
954334025 3:49905740-49905762 GGCTGTAGATAAGGAGGCTGGGG + Intronic
954582510 3:51710711-51710733 TGTGGGAGAGTAGGAGGCTGAGG - Intronic
954687348 3:52378113-52378135 AGTGGTAAAAATGCAGGCTGAGG + Intronic
954759026 3:52860785-52860807 TGTGGAAGAAAGGATGGCTGGGG + Intronic
954771261 3:52971474-52971496 TGGGGTAGAAAAGTAAACTGAGG - Intronic
955027690 3:55186376-55186398 TTTGATAGAAAAGGAATCTGAGG + Intergenic
955028314 3:55191597-55191619 TTTGATAGAAAAGGAATCTGAGG + Intergenic
955120542 3:56053645-56053667 TTTTGTAGATAAGGAAGCTGAGG - Intronic
955145337 3:56312325-56312347 TGTGGGTGAAAAGGAAGATGAGG + Intronic
955213133 3:56960693-56960715 TGTGGGTGAAGAGGAGGTTGAGG - Intronic
957585465 3:82126681-82126703 TGTGGGAGAAAAGTGGCCTGAGG + Intergenic
958426514 3:93984520-93984542 AGAGGTGGAAATGGAGGCTGGGG + Intronic
958458253 3:94360471-94360493 TTTGGTAGAACAGGCGGGTGAGG + Intergenic
959971426 3:112414146-112414168 AGTGGGAGAGAAGGAGACTGAGG - Intergenic
960943259 3:122948217-122948239 TTTGCTAGAAAAGGAAGTTGTGG - Intronic
961316239 3:126037737-126037759 TGTGGTAGAAAAGGAATCAAAGG + Intronic
961428728 3:126865054-126865076 GGTGGTGGAAAAGGAGGAGGAGG - Intronic
961428751 3:126865138-126865160 GGTGGTGGAAAAGGAGGTGGTGG - Intronic
963060309 3:141220176-141220198 GATGGTAGAATAGGAGTCTGGGG - Intergenic
963277724 3:143349399-143349421 TGTGGTTGTAAAGGAGGGTGGGG + Intronic
963784381 3:149518746-149518768 TGTAGAAGAAAAGAAGGCTTTGG - Exonic
964000004 3:151759627-151759649 TGTGGTAGAAATGTATGCTAAGG + Intronic
964256575 3:154781358-154781380 TGTGGTGGCATGGGAGGCTGAGG - Intergenic
964925498 3:161951628-161951650 TGTGGTTGAGCAGGAGGCAGGGG + Intergenic
966394963 3:179492869-179492891 TGTGGCAGCAAAGGATGTTGTGG - Intergenic
966865824 3:184258809-184258831 TGTGGTGGCAGAGGAGGTTGGGG - Intronic
966912335 3:184566438-184566460 TGTGGCAGGAAAGGAGGAGGTGG + Intronic
967019572 3:185510865-185510887 TGTTGTAGAAAAGAAAGCTTTGG - Intronic
967618491 3:191603141-191603163 TATAGGAGTAAAGGAGGCTGAGG + Intergenic
967914606 3:194569341-194569363 TGTGGTGGTGCAGGAGGCTGAGG + Intergenic
967950839 3:194839200-194839222 TTTCGCAGAAAAGGAAGCTGAGG + Intergenic
968288524 3:197521991-197522013 GGTGGCAGCAAAGGAGGTTGGGG - Intronic
968516700 4:1018557-1018579 TGTGCTGGAGGAGGAGGCTGGGG + Intronic
970378625 4:15483086-15483108 TATGGTGGATAAGGAGTCTGTGG + Intronic
971127559 4:23771132-23771154 TGTGCTAGAGAATGAAGCTGTGG - Intronic
972069239 4:34994513-34994535 AGTGGTAGAAAATGAGGTTCTGG - Intergenic
973576278 4:52292549-52292571 TTTAATAGAAAAGGAGGCTGAGG - Intergenic
974116293 4:57583359-57583381 TTTCCTAGGAAAGGAGGCTGTGG + Intergenic
975388563 4:73788315-73788337 GGAGGAAGAAAAGGAGGATGAGG + Intergenic
976154615 4:82129248-82129270 TTTGGTAGAAGAGGAGGCTATGG + Intergenic
976459539 4:85293258-85293280 TGTGCTAGGAAAGGAGCCTGGGG - Intergenic
976484563 4:85586537-85586559 TTTGATAGAAAAGGAAGCTGAGG + Intronic
976567204 4:86564678-86564700 GGTGGTAGAAAAGGAGGAAGGGG - Intronic
977814282 4:101396421-101396443 TGTGGTAGAAAAGGACAATCTGG - Intergenic
977931696 4:102757026-102757048 TGTGGCATAATAGCAGGCTGAGG + Intronic
978233866 4:106433554-106433576 TTGGTCAGAAAAGGAGGCTGGGG + Intergenic
978239789 4:106501853-106501875 AGGGGTAGAAAGGAAGGCTGAGG + Intergenic
979454487 4:120911667-120911689 TTTTGTAGATAAGGAGACTGAGG - Intronic
979456756 4:120934582-120934604 TGTGTTAAACAGGGAGGCTGAGG + Intergenic
979508418 4:121524534-121524556 TGGGGTAGGAAAGAAGGATGGGG + Intergenic
979717141 4:123853660-123853682 AGGGGTAGAAAAGGAGGCAAGGG - Intergenic
982108752 4:152034023-152034045 GCTGGGAGAAAAGGAGACTGAGG + Intergenic
984936567 4:184894949-184894971 AGTAGAAGAAAAGGAGGCCGGGG - Intergenic
985501978 5:253923-253945 GGTGGTAGCACAGGAGGCTGAGG + Intronic
986507159 5:8464123-8464145 TGATGTAGAAATGGATGCTGAGG - Intergenic
986901795 5:12443861-12443883 TGTGGTAGGAAATGAGGCAAGGG - Intergenic
987940759 5:24532789-24532811 TGTAGAAGAAAAGGAGGCTTAGG - Intronic
990240968 5:53816380-53816402 TGGGGGAGAGAAGGAGGCTCGGG - Intergenic
990601865 5:57367100-57367122 TGTGGCTGAAAGGGAGGCTGGGG + Intergenic
990660924 5:58014393-58014415 TATGGTAAAAACGGAGGGTGGGG - Intergenic
991021934 5:61988327-61988349 TGGGGTAGAAGAGGAGGAAGTGG - Intergenic
991302460 5:65142534-65142556 TCTGGAAGGAAAGCAGGCTGAGG + Intergenic
992320628 5:75610461-75610483 TTTGATAGAAAAGGATTCTGAGG - Intergenic
992942843 5:81779788-81779810 AGGGGTAGAAAAGGAGGCTGTGG + Intergenic
993183028 5:84579382-84579404 TGAGGAAGAAAAGAAGGATGAGG + Intergenic
993304459 5:86257717-86257739 TGTGGTAGAAAACCAGGGGGAGG - Intergenic
993640975 5:90405113-90405135 GGTAGTAGTAAAGGAGGCAGTGG - Intronic
994829050 5:104754283-104754305 TGTTGTATAAAAGGAGGTTATGG - Intergenic
994896466 5:105710428-105710450 TGTGCTGGAAAAGAAGCCTGGGG + Intergenic
996082219 5:119268758-119268780 GGCGGGAGAAAAGGAGGCAGAGG - Intronic
996316157 5:122163059-122163081 TATGGTAGAAACTGAGGCTTGGG - Intronic
996588943 5:125123969-125123991 TTTGGCAGAAAAGGAGACTGTGG + Intergenic
997105952 5:131019591-131019613 TGTGGTAGTACAGGAGGAAGGGG + Intergenic
997276108 5:132592509-132592531 TGTGGTGGAAAAGGACTCTCTGG + Intronic
997308769 5:132862029-132862051 TGTGGGAGAAGAGGCTGCTGAGG - Exonic
998217624 5:140249385-140249407 TGTGGTAGAATTGGTGTCTGGGG - Intronic
999371380 5:151057242-151057264 TTTGGTAGATGAGGATGCTGAGG - Intronic
999527903 5:152428066-152428088 TGTGGTAAGAGACGAGGCTGTGG + Intronic
999806488 5:155086161-155086183 TTGGGTAGAAAATGGGGCTGGGG + Intergenic
1000268951 5:159664730-159664752 AGTGGTGGAAAAGGAGCATGAGG - Intergenic
1000308693 5:160020177-160020199 AATGAAAGAAAAGGAGGCTGGGG - Intronic
1000352625 5:160363868-160363890 AGGGGTAGAGAAGGCGGCTGAGG + Intronic
1000795609 5:165660778-165660800 GGTGGGAGAAAAGGAGGCTATGG + Intergenic
1001598376 5:172913101-172913123 TGTGATAGAAGAGGAAACTGAGG + Intronic
1002100625 5:176855855-176855877 TGGGGTGGAGGAGGAGGCTGGGG - Intronic
1003109740 6:3243532-3243554 TGTGGTAGGTTGGGAGGCTGGGG + Intronic
1004142251 6:13029093-13029115 TTTGGTAGAAAAGGAAAATGAGG + Intronic
1004620035 6:17323949-17323971 TGTATTAGAGAAGGTGGCTGGGG + Intergenic
1004758245 6:18637300-18637322 TGTGGTAGAAAATGAGATTGAGG + Intergenic
1005994532 6:30923293-30923315 TCTGGAAGGAAAGGAGGCAGGGG + Intronic
1006377545 6:33679983-33680005 TGTGGTACATGAGGGGGCTGTGG - Exonic
1006473643 6:34241940-34241962 TGGGGTAGGAGGGGAGGCTGAGG - Intronic
1006506851 6:34494735-34494757 TTTGTTAGAAATGCAGGCTGTGG - Intronic
1006725882 6:36198411-36198433 TCTGGTACAAAACGAGGCTCTGG - Intronic
1007367147 6:41402866-41402888 GGGGGTAGGAGAGGAGGCTGGGG - Intergenic
1007507156 6:42344579-42344601 TGTGGTAGAAAAGATGGCCCGGG - Intronic
1007896674 6:45369176-45369198 TGTGGTAGAAAAGGAGGCTGGGG - Intronic
1007923401 6:45630783-45630805 TGTGGGAGAGAGAGAGGCTGGGG - Intronic
1008560675 6:52721714-52721736 TGAGGTAGAACAATAGGCTGAGG + Intergenic
1010060282 6:71614845-71614867 TGGAGTAGAAATGGAGGATGGGG - Intergenic
1010333087 6:74646983-74647005 TGTGGTAGTAATGGCGGCTTGGG - Intergenic
1010353291 6:74901563-74901585 TATGGTATAAGAAGAGGCTGTGG + Intergenic
1011555281 6:88566690-88566712 AGGGGAAGAACAGGAGGCTGAGG - Intergenic
1012423968 6:99094329-99094351 TGGGGGAGAAAAGGATACTGTGG + Intergenic
1013172099 6:107645971-107645993 GGTGGTAGAACAGGAGTTTGGGG + Intronic
1013345257 6:109253954-109253976 GGTGGTAGAATGGAAGGCTGAGG - Intergenic
1013681569 6:112529872-112529894 TGTGGTAGAAAAAGATGCTTTGG + Intergenic
1014218589 6:118777373-118777395 TGTGGGAGGAAAGGAAACTGTGG + Intergenic
1016059479 6:139614896-139614918 TGTGGTAGAGAAGGTCTCTGGGG + Intergenic
1016416863 6:143842897-143842919 TGCCGTAGCAACGGAGGCTGGGG - Intronic
1019270489 7:144389-144411 TTTGGAGGAAAAGCAGGCTGAGG - Intergenic
1019611906 7:1940995-1941017 TGGGGAGGAAGAGGAGGCTGAGG - Intronic
1019683505 7:2366666-2366688 TGTGCTAGAAGAGGAGGAGGAGG + Intronic
1021126456 7:16855575-16855597 TGTGAAAGAGAAGGGGGCTGGGG + Intergenic
1021892246 7:25197177-25197199 TGTGGTGGCTCAGGAGGCTGAGG - Intergenic
1022970985 7:35517143-35517165 GGGGGTAGAGAAGGAGGCTAGGG - Intergenic
1023025311 7:36044483-36044505 TGAGGTAGAAAAGGAATGTGTGG + Intergenic
1023221731 7:37926159-37926181 TGTGTTTGGAAAGGAGGATGAGG + Intronic
1024036361 7:45510435-45510457 TGTGGGAGAAAAGCAGGTAGGGG + Intergenic
1024563967 7:50666370-50666392 TGCTGTTGAATAGGAGGCTGAGG + Intronic
1025569753 7:62546448-62546470 TGTGGTGGAAAAGAGGCCTGTGG + Intergenic
1026739902 7:72972673-72972695 TGAGGTAAAGATGGAGGCTGGGG - Intergenic
1026797177 7:73373849-73373871 TGAGGTAAAGATGGAGGCTGGGG - Intergenic
1027103831 7:75392397-75392419 TGAGGTAAAGATGGAGGCTGGGG + Intergenic
1027296441 7:76777567-76777589 TTTGATAGAAAAGGAAACTGAGG - Intergenic
1027343617 7:77235527-77235549 TGTGTTGTGAAAGGAGGCTGTGG + Intronic
1028464504 7:91135219-91135241 TGGGGGTGAAAAGGAGGCAGAGG + Intronic
1028841126 7:95431155-95431177 AGGGGTGGAAAAGGAGGGTGTGG + Intronic
1028946746 7:96588648-96588670 TGTGGTAGCTCAGGAGGCTGAGG + Intronic
1029531299 7:101127068-101127090 TCTGGTATAAAAGGAGGCAGTGG + Exonic
1029945169 7:104525473-104525495 TGTAGCAGAAAAGGCTGCTGAGG + Intronic
1030620203 7:111781335-111781357 TGTGGGAGAAACTCAGGCTGAGG + Intronic
1030885199 7:114928529-114928551 AGTGGTAGAAAACAAGGCTTGGG + Intronic
1032135562 7:129273787-129273809 TGCGATAGAAAAGGTGGATGTGG + Intronic
1032308185 7:130756225-130756247 AGTGGTAGCAGAGGAGGCTGGGG + Intergenic
1032498035 7:132377587-132377609 TGTTGTAGAAGGGGAGGCTGTGG - Intronic
1033926525 7:146468943-146468965 TGTGGAAGAAAAAGAGGCACAGG + Intronic
1034312619 7:150102244-150102266 GGTTGTAGAAAAGGATGCTAGGG - Intergenic
1034359444 7:150481164-150481186 TGAGGAAGGAGAGGAGGCTGGGG - Intergenic
1034655182 7:152723500-152723522 TCTGGTAGAAATGCAGGCTGGGG + Intergenic
1034794238 7:153998413-153998435 GGTTGTAGAAAAGGATGCTGGGG + Intronic
1035747361 8:1972059-1972081 TCTGGTAGATAAGTAGTCTGTGG - Intergenic
1036769966 8:11572075-11572097 TGTCGTAGAAGAGCAGGCTTTGG + Intergenic
1037444515 8:18951483-18951505 TGTTGTAGGAATGGTGGCTGTGG - Intronic
1037712278 8:21364435-21364457 TCTGGTAGACAAGGCGGGTGGGG + Intergenic
1037866909 8:22451435-22451457 TGTAGTATTAAAGGAGGCTGGGG - Intronic
1037933489 8:22898769-22898791 TGTGGTTGAAATCCAGGCTGAGG + Intronic
1039079020 8:33717889-33717911 AGTGGTAGAAATGGGGGCTATGG + Intergenic
1039149342 8:34485767-34485789 TGTGGTAGAAATCGAGGTGGGGG - Intergenic
1039327035 8:36496894-36496916 GGAAGCAGAAAAGGAGGCTGCGG - Intergenic
1039785364 8:40829981-40830003 GATGGAAGAAAAAGAGGCTGGGG + Intronic
1039926923 8:41942843-41942865 GGAGGAAGAAGAGGAGGCTGAGG - Exonic
1040040554 8:42912655-42912677 TGTGGTGGGCAAGGAGGATGTGG - Intronic
1040106668 8:43545761-43545783 TGAGGCTGAAGAGGAGGCTGGGG - Intergenic
1040110146 8:43563631-43563653 GGAGGCTGAAAAGGAGGCTGGGG - Intergenic
1040110700 8:43566084-43566106 TGAGGCAGAAGAGGAGGATGGGG - Intergenic
1040111581 8:43569179-43569201 TGTGGCCAAAAAGGAGGCCGAGG - Intergenic
1040859818 8:51987396-51987418 TGTGCTATAAAAGGAGAATGAGG - Intergenic
1040903984 8:52445984-52446006 TGTGGAAGAAAAGGAAGTTTTGG - Intronic
1042863126 8:73333570-73333592 TAAGGCAGAAAAGGAGACTGAGG - Intergenic
1043186020 8:77150899-77150921 TGGGTAAGAAAATGAGGCTGAGG - Intergenic
1043368697 8:79565545-79565567 TGTACAAGAAAAGGAAGCTGAGG + Intergenic
1044123355 8:88425589-88425611 TAAGGCAGAAAAGGAGACTGAGG - Intergenic
1044519276 8:93178872-93178894 TGTGTTATAAAATGAGGTTGGGG + Intergenic
1044686917 8:94834922-94834944 TGTGGTATAAAAGGAGTAAGGGG + Intronic
1044948598 8:97414376-97414398 TGCTGTAGAAAAGGAAGGTGGGG - Intergenic
1045126156 8:99091136-99091158 TGTGGGTGAAAAGAAGGCAGAGG + Intronic
1045388825 8:101694972-101694994 TGTGGGAGCAAAGCAAGCTGGGG - Intronic
1046136261 8:110031572-110031594 TGTGGGAGAAGAGGAGTCAGGGG + Intergenic
1046425871 8:114047942-114047964 TCTTGAAGAAAAGGAAGCTGAGG - Intergenic
1046678021 8:117134098-117134120 TGTGCTCTAAAAGGAGGATGGGG - Intronic
1047162494 8:122396341-122396363 TGTGGTGGGAGAGGATGCTGAGG - Intergenic
1047823661 8:128550030-128550052 TGTTTTAGAAAAGAAAGCTGAGG - Intergenic
1048275537 8:133063007-133063029 GATGATAGACAAGGAGGCTGAGG - Intronic
1048656557 8:136544279-136544301 GGAGGTAGAAAGGGAGGCTGTGG - Intergenic
1049270957 8:141696058-141696080 TAAGGCAGAACAGGAGGCTGAGG + Intergenic
1049447229 8:142636823-142636845 TGTGGAGGGGAAGGAGGCTGCGG + Intergenic
1049664684 8:143837683-143837705 CGCGGTGGAAGAGGAGGCTGTGG + Exonic
1049705926 8:144042149-144042171 TGTGTCAAAAAAAGAGGCTGGGG - Intronic
1050993985 9:12190349-12190371 AATGGAAGAGAAGGAGGCTGGGG + Intergenic
1051717532 9:20000632-20000654 TGTGGCAGATATGGAGACTGCGG - Intergenic
1052523380 9:29580110-29580132 TGTGGTAGAATTGGAGATTGGGG - Intergenic
1053588524 9:39485813-39485835 TATGGAAGAGAAGGAAGCTGAGG + Intergenic
1056755419 9:89379030-89379052 AGTTGTAGAAAAAGAGGCAGAGG + Exonic
1056833204 9:89933163-89933185 GGTGGGAGAAAAGGACTCTGAGG + Intergenic
1056926713 9:90840401-90840423 AGTGGGGGAAAAGCAGGCTGGGG + Intronic
1057426108 9:94951021-94951043 TGTGGTGGAAAAGGAAGGCGTGG + Intronic
1059136019 9:111807185-111807207 TATGGTGGGAAATGAGGCTGTGG + Intergenic
1059653314 9:116334916-116334938 TGTGGTAGAAGGGCTGGCTGAGG - Exonic
1061357852 9:130119919-130119941 TGAGGTAGGAGGGGAGGCTGAGG - Intronic
1061446236 9:130639839-130639861 TGTGGTACGACAGGAGGCGGGGG + Intergenic
1061546536 9:131307996-131308018 TGAGGTAGTCCAGGAGGCTGGGG - Exonic
1061912284 9:133731571-133731593 TCTGGGAGAAAGTGAGGCTGGGG - Intronic
1062191462 9:135249892-135249914 TGTGGAAGACAAGGCTGCTGGGG + Intergenic
1062215757 9:135389026-135389048 TGTGGTAAGCAATGAGGCTGAGG - Intergenic
1187355071 X:18560917-18560939 TGTAGTAGAAAAGAAGTATGAGG - Intronic
1187609695 X:20928826-20928848 TGTTGTAGATAAGGAAACTGAGG + Intergenic
1188833191 X:34926478-34926500 AGTGGTAGAAAAGGAGGAGAAGG - Intergenic
1189905342 X:45753610-45753632 TGGGGAAGGGAAGGAGGCTGAGG + Intergenic
1189907362 X:45775148-45775170 GGTGGGAGAAAGGGAGGATGAGG + Intergenic
1190873182 X:54441749-54441771 AGTGGTAGAGAATGAAGCTGGGG + Intronic
1191258704 X:58291173-58291195 TGTGGCCAAATAGGAGGCTGTGG + Intergenic
1192531130 X:71887169-71887191 TGTGGTAGAGAAGAACGCTCCGG - Intergenic
1192981725 X:76351313-76351335 GGTGGTAGACAAGGGGGATGTGG - Intergenic
1194704170 X:97154217-97154239 TTTTATAGAAAAGGAGACTGAGG + Intronic
1196457351 X:115899943-115899965 GGTGGTAGAAACGGAGGGAGTGG - Intergenic
1196673351 X:118393026-118393048 TTTAGTAGATAAGGAGTCTGAGG - Exonic
1196835544 X:119810644-119810666 TGTGATAGAAAAGGACTCTCTGG - Intergenic
1196836581 X:119819423-119819445 CGTGGTAGAAAAGGACTCTCTGG - Intergenic
1196837501 X:119827040-119827062 CGTGGTAGAAAAGGACTCTCTGG - Intergenic
1196854444 X:119969788-119969810 CGAAGTGGAAAAGGAGGCTGCGG - Intergenic
1197243944 X:124149030-124149052 TGTTGTATACAAGGAGGTTGTGG + Intronic
1197717546 X:129720206-129720228 TGAGGCTGAAAAGGAGGATGTGG - Intergenic
1197965478 X:132056525-132056547 GGTGGAAGAAAAAGAGACTGGGG - Intergenic
1198175685 X:134152132-134152154 TTTGATAGAAGATGAGGCTGAGG - Intergenic
1198196825 X:134371914-134371936 GCTGGTAGAAAATGATGCTGGGG + Intergenic
1198438786 X:136641556-136641578 TCTGGTAGAAAGGGAGAGTGAGG + Intergenic
1198761067 X:140033070-140033092 TTTGGTGGAAGAGGAGGCTATGG + Intergenic
1199544390 X:148992236-148992258 TGTTGTTGCAAAGGAGGCAGAGG - Exonic
1199805773 X:151298955-151298977 TGAGGAAAAAAAGGAGACTGAGG - Intergenic
1200161980 X:154014251-154014273 CCTGGTGGAAGAGGAGGCTGAGG - Exonic
1200787208 Y:7271751-7271773 TTTGGTAGAGATGGGGGCTGGGG + Intergenic