ID: 1007901990

View in Genome Browser
Species Human (GRCh38)
Location 6:45421761-45421783
Sequence TTCTCGCGGCCGGCTGGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 75}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007901977_1007901990 22 Left 1007901977 6:45421716-45421738 CCGCCTCTAGGCTTCGGAAACTG 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1007901990 6:45421761-45421783 TTCTCGCGGCCGGCTGGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 75
1007901978_1007901990 19 Left 1007901978 6:45421719-45421741 CCTCTAGGCTTCGGAAACTGCAC 0: 1
1: 0
2: 0
3: 7
4: 64
Right 1007901990 6:45421761-45421783 TTCTCGCGGCCGGCTGGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007901990 Original CRISPR TTCTCGCGGCCGGCTGGCGG CGG Intronic
900082605 1:869862-869884 TTCGCGCTGCCGCCTGGCTGGGG + Intergenic
900786942 1:4655286-4655308 GCCCCGCGGCCGGCGGGCGGCGG + Exonic
908360895 1:63367664-63367686 TCCCAGCGGCCGGCGGGCGGCGG + Exonic
914928572 1:151909589-151909611 TACTGGCGGCTGGCTGGCCGGGG + Exonic
919748637 1:201023524-201023546 TGCTCGCGGGCGGCAGGCCGAGG + Exonic
920385794 1:205569420-205569442 TGGTCGCGGCCGGGAGGCGGGGG - Intronic
920887000 1:209938568-209938590 TCCGCGCGGCCGGCAGGAGGCGG - Intronic
922674619 1:227542746-227542768 TTCGCGCTGCCGCCTGGCTGGGG - Intergenic
1065550014 10:26860716-26860738 CTCTGGCGGCCGGCGGGCGCTGG - Intronic
1066406847 10:35126872-35126894 TGCTGGCGGCCGGCAGGGGGCGG + Intronic
1067015628 10:42754930-42754952 TTCTCGCGGCCGGACCGCGCCGG + Intergenic
1076897619 10:133321053-133321075 TTGCCGCTGCCGGCTGGGGGTGG + Intronic
1077228602 11:1448908-1448930 CCCTCGTGGCCGGCTGGCGGTGG + Intronic
1077976263 11:7251856-7251878 TACTCGCGGCCGCCGGGGGGCGG - Intronic
1079375997 11:19892570-19892592 TTCTCGTGGCTGCTTGGCGGTGG - Exonic
1088654150 11:111983269-111983291 CTCTGGCAGCCGGCAGGCGGTGG + Intronic
1100260459 12:92928664-92928686 TTCTCCAGCCCGGCAGGCGGCGG + Intronic
1102922743 12:116804678-116804700 TTCTCGAGGCAGGCTGGGTGCGG + Intronic
1123500612 15:20878039-20878061 TGCTCTCGCCCGGCTGGCAGGGG - Intergenic
1123557857 15:21451732-21451754 TGCTCTCGCCCGGCTGGCAGGGG - Intergenic
1123594084 15:21889013-21889035 TGCTCTCGCCCGGCTGGCAGGGG - Intergenic
1127084086 15:55408453-55408475 TTCCCGCAGCCGCCCGGCGGCGG - Intronic
1128335284 15:66781577-66781599 CTCTCGAGGCCGGCAGGTGGCGG - Exonic
1202966208 15_KI270727v1_random:178904-178926 TGCTCTCGCCCGGCTGGCAGGGG - Intergenic
1134134036 16:11668300-11668322 TGCTCGGGGCCGGCAGGCGGTGG - Intergenic
1145793803 17:27644185-27644207 TGCTCGAGGCAGGCTGGCAGAGG - Intronic
1146229488 17:31095283-31095305 TCCCCGCGGCCGGGGGGCGGCGG - Exonic
1150347045 17:64412256-64412278 TTCGCGCTGCCGGCTGGTGGGGG - Intronic
1156961459 18:43036550-43036572 TTTGCGGGGCAGGCTGGCGGGGG - Intronic
1160685926 19:436572-436594 GTCTCGCGGCCGGAGGGGGGCGG + Intronic
1160880826 19:1319192-1319214 TCATCACGGCCGGCCGGCGGGGG - Intergenic
1161752924 19:6110542-6110564 TGCGCGAGGCTGGCTGGCGGCGG - Intronic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
932953854 2:76327793-76327815 TTCTCGTGGCCAGCTTGCTGGGG - Intergenic
933923867 2:87075567-87075589 CTCCCGGGGCCGGCTGGGGGCGG + Intergenic
935787431 2:106561502-106561524 TTCTGGCAGCCTGCTGGCTGTGG + Intergenic
937221797 2:120346235-120346257 TGCTGGCGGCCGGCTGGCTGGGG + Exonic
937257767 2:120566976-120566998 TGCTCCTGGCCGGCTGGCAGAGG - Intergenic
1169455194 20:5746456-5746478 TTCATGCAGCTGGCTGGCGGTGG + Intergenic
1171180827 20:23089126-23089148 TTCTCGGGGCTGGGTGGAGGTGG + Intergenic
1175859454 20:62142770-62142792 TTCACGCAGCCGGGTGGCTGGGG - Intronic
1179788211 21:43741355-43741377 GGCTCGCGGGGGGCTGGCGGGGG + Intronic
1182697185 22:32205499-32205521 TGCCCGCGGCCGGGGGGCGGGGG + Intergenic
1183664021 22:39237101-39237123 TTCTCGCTGCCTGACGGCGGAGG + Intronic
1185107641 22:48883368-48883390 TGCTGGCGCTCGGCTGGCGGTGG + Intergenic
969681873 4:8647666-8647688 TTCTCGCGTCCACCAGGCGGGGG + Intergenic
982171878 4:152670214-152670236 TTCTCCAGGAAGGCTGGCGGGGG + Intronic
985980220 5:3456546-3456568 TCCTCCCGGCTGGCTGGCTGTGG - Intergenic
986858802 5:11903706-11903728 GGCTCCCGGCCGGCAGGCGGCGG - Intronic
986858929 5:11904154-11904176 TCAGCCCGGCCGGCTGGCGGCGG - Intergenic
992249793 5:74865963-74865985 GGCTCGCGTCCAGCTGGCGGCGG - Intronic
996717789 5:126601357-126601379 TCCTGGAGGCCGGCTTGCGGCGG + Intronic
998377872 5:141702886-141702908 GTGTCACGGCCGGCTGGCTGGGG + Intergenic
998401332 5:141850512-141850534 TGCTCGCGGCGGGGTGGGGGGGG + Intergenic
1002289058 5:178187364-178187386 TGCTCGGGGAAGGCTGGCGGCGG - Intergenic
1007702272 6:43772065-43772087 TTCCCGCGGAGGGCTGGCGGGGG - Intronic
1007901990 6:45421761-45421783 TTCTCGCGGCCGGCTGGCGGCGG + Intronic
1008956615 6:57222365-57222387 TTCTGGCGGGTGGCTGGCGGCGG + Intergenic
1011099957 6:83709276-83709298 TTCTCCCCGCCGGCTTGCCGGGG - Exonic
1017935199 6:158999479-158999501 TGCTCGGGGCCGGCTGGTGTAGG + Exonic
1018240993 6:161774558-161774580 TTCATGGGGCCAGCTGGCGGAGG - Intronic
1018728489 6:166631484-166631506 TCCTCACAGCGGGCTGGCGGGGG - Intronic
1019770905 7:2883202-2883224 TGCTGGCGGCCAGCTGGGGGTGG + Intergenic
1034800592 7:154053072-154053094 TTCTCGGGGGCGGGGGGCGGCGG + Intronic
1037769029 8:21788319-21788341 TTCTCGCCTCTGGCTGGAGGGGG + Exonic
1049628169 8:143636025-143636047 CGGTCGCGGCGGGCTGGCGGCGG + Intronic
1049990032 9:981809-981831 TTCTCGCCGCCTGCTGGGGACGG + Intronic
1057313461 9:93955279-93955301 TCCGCCCGGCCGGCCGGCGGGGG - Exonic
1059247258 9:112859090-112859112 TTCTAGAGGCCGGCAGGAGGGGG - Intronic
1062656252 9:137605662-137605684 GACTCGCGGGCGGCGGGCGGGGG + Exonic
1203760794 EBV:12403-12425 TCCTCGGGGCCAGCTGCCGGGGG - Intergenic
1203761723 EBV:15475-15497 TCCTCGGGGCCAGCTGCCGGGGG - Intergenic
1203762652 EBV:18547-18569 TCCTCGGGGCCAGCTGCCGGGGG - Intergenic
1203763581 EBV:21619-21641 TCCTCGGGGCCAGCTGCCGGGGG - Intergenic
1203764510 EBV:24691-24713 TCCTCGGGGCCAGCTGCCGGGGG - Intergenic
1203765439 EBV:27763-27785 TCCTCGGGGCCAGCTGCCGGGGG - Intergenic
1203766368 EBV:30835-30857 TCCTCGGGGCCAGCTGCCGGGGG - Intergenic
1203767297 EBV:33907-33929 TCCTCGGGGCCAGCTGCCGGGGG - Intergenic
1189187834 X:39069556-39069578 TTGTCGCAGCTGGCTGGGGGTGG + Intergenic
1198276042 X:135097303-135097325 TTCTCGAGGCCGTCTGGGGCTGG + Intergenic
1200209596 X:154341414-154341436 ATCTCGCGGGCGGGAGGCGGAGG + Intergenic
1200221280 X:154390714-154390736 ATCTCGCGGGCGGGAGGCGGAGG - Intronic