ID: 1007903316

View in Genome Browser
Species Human (GRCh38)
Location 6:45432407-45432429
Sequence TAAGTTGTAGCAAGGACAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007903314_1007903316 -1 Left 1007903314 6:45432385-45432407 CCTGGTAATATCAATTTTGGTCT 0: 1
1: 0
2: 0
3: 10
4: 139
Right 1007903316 6:45432407-45432429 TAAGTTGTAGCAAGGACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007903316 Original CRISPR TAAGTTGTAGCAAGGACAGC TGG Intronic
No off target data available for this crispr