ID: 1007908035

View in Genome Browser
Species Human (GRCh38)
Location 6:45483857-45483879
Sequence AGTGTGAGTAGAGCACAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007908035 Original CRISPR AGTGTGAGTAGAGCACAAGC TGG Intronic
901021425 1:6257886-6257908 AGTGTGAGCAGAGCACAAGTAGG - Intronic
901125183 1:6924176-6924198 GGTGTGAATAGTGCACAAGAGGG + Intronic
903139362 1:21329830-21329852 AGTTTGTGAAGAGCAAAAGCAGG + Intronic
908638714 1:66198065-66198087 AATGTGAGTAGAGATCAAGTAGG + Intronic
909438271 1:75669338-75669360 AGAGGGAGTAGACCATAAGCAGG - Intergenic
911015067 1:93323375-93323397 ACTTTGAGTAGAGCCCCAGCAGG - Intergenic
911533254 1:99071100-99071122 AGGGAGAGCAGAGGACAAGCTGG - Intergenic
911536419 1:99105963-99105985 AGTGCGGGTAGAGCACCAACTGG + Intergenic
917199487 1:172499937-172499959 ACTGAGACTAGAGCTCAAGCAGG + Intergenic
918716027 1:187787950-187787972 AGTTTGAGCAGGGCACAGGCTGG + Intergenic
920700488 1:208214675-208214697 AGTGTGAGAAGTGCAAAAGTAGG - Intronic
920955438 1:210615987-210616009 AGCGTGAGTATAGCAGAAGATGG - Intronic
921740481 1:218679138-218679160 AGTGGGACAAGAGCAGAAGCTGG + Intergenic
922618214 1:226975722-226975744 GGCGTGAGTAGAGCACTCGCCGG - Intronic
924852682 1:247846350-247846372 TGTGGGAGGAGAGAACAAGCAGG - Intergenic
1066535728 10:36389388-36389410 AGAATGAGAAGAGAACAAGCTGG - Intergenic
1068915133 10:62422921-62422943 GGTGTGAGTTGAGAACAAGTTGG - Intronic
1073917668 10:108425496-108425518 AGTGTGAGTATAACAGAATCAGG + Intergenic
1075969688 10:126642013-126642035 AGGGTGCATAGAGCCCAAGCAGG - Intronic
1077899117 11:6475645-6475667 AGGGTGAGTAGATGACAAACAGG - Intronic
1077970270 11:7181900-7181922 TGGTTGAGTAGAGCACAAGCAGG + Intergenic
1078753426 11:14186630-14186652 AGGGTGGGTACAGCATAAGCAGG - Intronic
1080452936 11:32393661-32393683 AGTGTGAGCAGAGTGCAAGGAGG - Intronic
1082990800 11:59205785-59205807 ACTGTGAGTGGAGCCCATGCTGG + Exonic
1083935394 11:65867277-65867299 AGGGTGAGAAGAGCCCCAGCAGG - Intronic
1085323328 11:75588210-75588232 TGTGAGAGTAGAGCTCAGGCAGG + Intronic
1088915599 11:114225537-114225559 AGAGAGAGCAGAGCACAAGAGGG + Intronic
1090813094 11:130264888-130264910 AATGTGAAGTGAGCACAAGCTGG - Intronic
1090893367 11:130947649-130947671 AGTGTGGGTAGAGAAAAAGATGG + Intergenic
1091546218 12:1503049-1503071 AGTGTGAGGAGAGCAGAAGCAGG - Intergenic
1092254600 12:6919528-6919550 AGTGAGATTATAGTACAAGCAGG - Intronic
1093019197 12:14187478-14187500 ACTCTGAATACAGCACAAGCAGG + Intergenic
1093486571 12:19659356-19659378 AATGTGATTAGAGAAAAAGCTGG - Intronic
1093540114 12:20272400-20272422 TTGGTGAGCAGAGCACAAGCAGG + Intergenic
1102959819 12:117085210-117085232 AGTGTGGGTAGAAAACAGGCAGG + Intronic
1103672976 12:122633323-122633345 AGTGTGATCAGTGAACAAGCAGG - Intergenic
1105350499 13:19610752-19610774 AGGGTGAGTAGACCACACGATGG - Intergenic
1109572081 13:64206504-64206526 AGTGTGAGCCAAGCACAACCTGG - Intergenic
1110613390 13:77514122-77514144 GGTGTGATTAGAACAAAAGCAGG - Intergenic
1110617633 13:77558859-77558881 AATGTTAGTAGAGCATAACCAGG + Intronic
1111224977 13:85258129-85258151 GATGTGAGTAAAGCAAAAGCTGG + Intergenic
1118292782 14:64541158-64541180 AGTGCAAGTAGAGTACAAGGGGG + Exonic
1119147475 14:72330254-72330276 AGTGTGTGTAACACACAAGCCGG + Intronic
1120921508 14:89760113-89760135 AGTGTGAATAGAAAACAACCAGG + Intergenic
1121506426 14:94481121-94481143 AGGGTGAGTAAACCACAGGCTGG + Intergenic
1125037565 15:35143479-35143501 AGTGTGAGGAGAGCAGAGGCTGG + Intergenic
1126892746 15:53223564-53223586 TGTGTGAGTAGAGGACAATAGGG + Intergenic
1129078592 15:73019778-73019800 AGAGAGAGTTGAGCACAAGGGGG + Intergenic
1131143736 15:89998983-89999005 AGTGAGGATAGAGCACAAGTGGG - Intergenic
1133983505 16:10650928-10650950 AGTGTTTCTAGTGCACAAGCAGG - Intronic
1137889682 16:52146062-52146084 TGTCTGGGTAGAGCAGAAGCTGG - Intergenic
1138622080 16:58219536-58219558 AGTCTGAGTACAGGACAAGCTGG - Intergenic
1139313985 16:66051888-66051910 AGTGTGGCTAGAGTATAAGCAGG - Intergenic
1141131316 16:81439076-81439098 AATGTGAATAGAGCCCAAGTTGG + Intergenic
1147670209 17:42172732-42172754 AGTGGCTGTAGAGCACAAGGTGG - Intronic
1148973126 17:51501976-51501998 AGTGGGAGTTGAGCTCAAGAAGG + Intergenic
1149718658 17:58820106-58820128 AGTGTGAGGAGAGAACCAGGGGG + Intronic
1150002245 17:61448490-61448512 TCTGTGAGTAGAGCCAAAGCCGG - Intergenic
1155231604 18:23779859-23779881 AGTGTGGGTAGGGCAGAAGCAGG - Intronic
1156172901 18:34507248-34507270 AGTGAGAGTAGAGCAAGAGCTGG - Intronic
1156959154 18:43002287-43002309 AGTGTGACTAGAATAAAAGCAGG - Intronic
1157142344 18:45122320-45122342 AGTGTGTGGAGAGCACAATAAGG + Intergenic
1158298488 18:56026320-56026342 AGTGAGAGCAAAGAACAAGCAGG + Intergenic
1164129739 19:22350681-22350703 CCTGTGGGCAGAGCACAAGCAGG - Intergenic
1164169809 19:22715345-22715367 CCTGTGGGCAGAGCACAAGCAGG + Intergenic
1164285611 19:23813695-23813717 ATTGTCAGTAGAAAACAAGCAGG - Intronic
1165828579 19:38719409-38719431 CATGTGAGGAGGGCACAAGCTGG - Intronic
1166367056 19:42283226-42283248 AGTGTGTGTAGTGGACAAGCAGG + Intronic
926049768 2:9737451-9737473 AGGGTGAGTAGGGCACTAGGGGG - Intergenic
932790309 2:74649139-74649161 AGTGGGACTAGAATACAAGCAGG - Intergenic
933063440 2:77767524-77767546 AGTGAGAGCCAAGCACAAGCAGG + Intergenic
936291614 2:111228571-111228593 AGTGTGAATGGAGAACACGCAGG + Intergenic
938210121 2:129460036-129460058 AGTTTAAGGAGAGGACAAGCAGG + Intergenic
939632375 2:144540596-144540618 AGGGTGAGTAGAGGGCAAGTTGG - Intergenic
939744526 2:145952270-145952292 AGTGTGAGCAAAGCAGAAGATGG - Intergenic
941986522 2:171516529-171516551 AGTGTGAGAAAATCACAGGCAGG - Intergenic
942156916 2:173139214-173139236 ATTATGAGTAGAGCACACACTGG - Intronic
944191631 2:197010024-197010046 AGTGTGAGGGGAGCAGGAGCAGG + Intronic
946276956 2:218638762-218638784 AGTGTGAGTACTGCACCAACCGG - Exonic
947744149 2:232499052-232499074 AGTGGGGGTGGAGCACAGGCTGG - Intergenic
948521157 2:238538887-238538909 AGTGTGAGCACTGCACAAGGAGG - Intergenic
948521631 2:238542617-238542639 AGTGTGAGTACTGCACCAGGAGG - Intergenic
948602929 2:239117503-239117525 AATGTGAGCAGAGCAAAGGCTGG + Intronic
1170058253 20:12230969-12230991 AGTGTGACTGGAGCAAAAACAGG - Intergenic
1175020742 20:55846183-55846205 AGTGTTACCAGAGCACAACCTGG - Intergenic
1175641922 20:60637711-60637733 AGTGTGACAAAAGAACAAGCTGG - Intergenic
1181562833 22:23715562-23715584 ACTGTGAGTGGGGCACACGCTGG + Intergenic
1183316797 22:37141483-37141505 AGTGTGAGTCGGGGACAAGCGGG + Intronic
950312357 3:11969648-11969670 AGTGGGGGTAGAGCATAGGCAGG - Intergenic
952409496 3:33034446-33034468 AGTGGAAGGAGAGCAGAAGCTGG + Intronic
952714065 3:36460671-36460693 AGTGTCAGTAGTGCAGAGGCTGG + Intronic
955609987 3:60746632-60746654 AATGTGAGGAAAGCACAAGGAGG + Intronic
955664059 3:61331737-61331759 AGTGTGCGTACAGCAGAGGCAGG + Intergenic
957453856 3:80415724-80415746 AGTGTGGGTAGAATAAAAGCAGG - Intergenic
959538004 3:107509060-107509082 AGTGTGAGTCGAGGGCAAGGAGG - Intergenic
961454543 3:127017553-127017575 AGGTGGAGTTGAGCACAAGCAGG - Exonic
963062781 3:141238473-141238495 AGTGTATGTTGAGTACAAGCTGG - Intronic
969049637 4:4363592-4363614 AGTGTGGGCAGAGCACAGACTGG + Intronic
970853098 4:20625218-20625240 ATTGTGAGCAGAGAGCAAGCAGG - Intergenic
971573963 4:28250758-28250780 TGTGTAAGAAGAGCACAAGAGGG + Intergenic
975345987 4:73293163-73293185 AGTGTGAGTAACGCAGAAGTTGG - Intergenic
976899822 4:90158957-90158979 AGTGTGAGTGAAGCAGAAGACGG - Intronic
978602081 4:110439353-110439375 AGTGTGACCAGAATACAAGCAGG - Intronic
980801003 4:137750327-137750349 AGTGGCAGTAGAGCAGAAGAGGG - Intergenic
980805903 4:137812814-137812836 AGTGTGAGTAGAGAAAATGGAGG + Intergenic
981340104 4:143611907-143611929 ACTGTGGGTAGAGCAGTAGCAGG - Intronic
982538357 4:156636170-156636192 AGAGGGAGTAGACCACATGCAGG - Intronic
985314807 4:188645949-188645971 AGTGTGATTGGAGGACAAACGGG + Intergenic
986225699 5:5810078-5810100 AGTGTGGCTAGAACATAAGCAGG + Intergenic
986553393 5:8983610-8983632 AGTATGTGTATAGAACAAGCAGG - Intergenic
989267909 5:39499029-39499051 TGTAAGAGTAGAGCACAGGCAGG + Intergenic
989635348 5:43525786-43525808 ACTGTGAGTAGAGCAGTAGTTGG + Intergenic
990558615 5:56961683-56961705 TGTGTGAGTACAGAAGAAGCAGG - Intronic
992581535 5:78183201-78183223 AGTGTCAGTGGAGGATAAGCAGG + Intronic
993740156 5:91528940-91528962 AGTGTTACTGGAGCACAAGTGGG - Intergenic
995385414 5:111583395-111583417 AGTGTGATTTGAGAAAAAGCAGG + Intergenic
997330338 5:133055751-133055773 AGTGAGAGTATAGAATAAGCGGG + Intronic
997759867 5:136434579-136434601 AGTGTTAGGAGAACACAAGAGGG - Intergenic
998625706 5:143843290-143843312 ACAGGGAGTAGAGCACAGGCTGG + Intergenic
999642309 5:153683898-153683920 AGAATGAGCAGAGCACAACCTGG + Intronic
1001233499 5:170010047-170010069 AGGGTCATCAGAGCACAAGCTGG + Intronic
1001268094 5:170289789-170289811 AGTGGGAGTAGTTCAGAAGCAGG - Intronic
1003154874 6:3583931-3583953 TGTGTGAGGAGGGCACAGGCTGG - Intergenic
1003536351 6:6978847-6978869 AGTGTCAGTAGAGCACAAAGAGG + Intergenic
1006044477 6:31283105-31283127 AGTGTCAGTACATTACAAGCTGG + Intronic
1007908035 6:45483857-45483879 AGTGTGAGTAGAGCACAAGCTGG + Intronic
1008654298 6:53595916-53595938 AGTGAGAGCAGAGCAGATGCTGG + Intronic
1008929786 6:56926658-56926680 AGTGTGAGTAAAGGAAAAGGTGG - Intronic
1011745846 6:90407140-90407162 AGTGTGGGGAGAGCAGAAGTTGG - Intergenic
1013584142 6:111563753-111563775 ACTGTGACTAGAGCACAAGATGG + Intronic
1015687215 6:135877942-135877964 AGGGTTACTAGAGCAGAAGCAGG + Intronic
1015824659 6:137298778-137298800 AGTATGATTAGAGGACAAGATGG - Intergenic
1015931269 6:138362435-138362457 ATTGTGAGTAGAGGAGCAGCTGG - Intergenic
1016304753 6:142672017-142672039 AGTGTGAGCATACCACAAGATGG + Intergenic
1018308937 6:162488695-162488717 TGTGTGAGAACAGCACGAGCAGG + Intronic
1019616577 7:1965634-1965656 AGTGTGCGAAGAGCAGAGGCAGG - Intronic
1022399036 7:30018308-30018330 AGTGTGAGTAGATAAAAAACAGG + Intronic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1025230797 7:57202195-57202217 ACTGTGAGTAGGGCACACACTGG + Intergenic
1027224895 7:76237654-76237676 AGTGTGGGCAGAGGACAAGAGGG + Intronic
1028038714 7:86019731-86019753 ATTGTCAGCAGAGCAGAAGCCGG - Intergenic
1028398129 7:90394805-90394827 AGAGTGAGTTGAGCAAGAGCAGG + Intronic
1033383835 7:140852066-140852088 ACTGTGAGAACAGCAGAAGCTGG + Intronic
1033951443 7:146789923-146789945 AGTGTGAGATGAGAACAATCTGG + Intronic
1036424279 8:8629026-8629048 AGAGTGAGTAGAAGACAACCAGG + Intergenic
1036540149 8:9699616-9699638 AGGGTGAGTGCAGAACAAGCTGG - Intronic
1040379907 8:46862490-46862512 CATGTGAGTAGAGCCCAAGGAGG - Intergenic
1040843067 8:51804956-51804978 AGTGTGGATGGAGCCCAAGCAGG - Intronic
1041354619 8:56987416-56987438 AGTGTGAATAGAACAAAAGGAGG + Intronic
1043363580 8:79504185-79504207 AGTGTGGCTAGAACATAAGCAGG + Intergenic
1044725393 8:95190708-95190730 GGTGTGAGGAGAGCTCAAGAGGG - Intergenic
1051369269 9:16344397-16344419 AGTGTGCGTAGAGCTCATGTGGG - Intergenic
1052358756 9:27531117-27531139 TGTGTGAGTAGAACACGTGCTGG - Intergenic
1062502632 9:136857929-136857951 AGTGTGGGGAGAGCACCTGCAGG - Intronic
1062518909 9:136949612-136949634 AGGGTGAGCAGAGGACAGGCCGG + Intronic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1186939002 X:14483877-14483899 AGTGTGGCTAGAACATAAGCAGG + Intergenic
1187311175 X:18144481-18144503 AGGGTGAGTAGAACACAGACCGG + Intergenic
1189901015 X:45706320-45706342 AGTGTGCCTAGAGCACAATGAGG - Intergenic
1190130662 X:47745904-47745926 AGAGGGAGTAGAGCATAAGTAGG + Intergenic
1192191246 X:68992522-68992544 GGTGTGAGGTGAGCACATGCAGG + Intergenic
1197257151 X:124275554-124275576 AGTGTTAGTAGACCACCAGAAGG - Intronic
1200849667 Y:7870009-7870031 CTTGTGAGTAGGGCACAAGGAGG + Intergenic
1202165890 Y:21987332-21987354 AGTGTGAGTGAAGCAGAAGATGG - Intergenic
1202225468 Y:22599040-22599062 AGTGTGAGTGAAGCAGAAGATGG + Intergenic
1202317645 Y:23596621-23596643 AGTGTGAGTGAAGCAGAAGATGG - Intergenic
1202553121 Y:26073437-26073459 AGTGTGAGTGAAGCAGAAGATGG + Intergenic