ID: 1007909078

View in Genome Browser
Species Human (GRCh38)
Location 6:45495057-45495079
Sequence GCCACTGTGTTATCTTCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 185}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007909074_1007909078 -10 Left 1007909074 6:45495044-45495066 CCCATCCTCCAAGGCCACTGTGT 0: 1
1: 0
2: 8
3: 24
4: 244
Right 1007909078 6:45495057-45495079 GCCACTGTGTTATCTTCTTCAGG 0: 1
1: 0
2: 0
3: 18
4: 185
1007909073_1007909078 -7 Left 1007909073 6:45495041-45495063 CCACCCATCCTCCAAGGCCACTG 0: 1
1: 0
2: 2
3: 43
4: 378
Right 1007909078 6:45495057-45495079 GCCACTGTGTTATCTTCTTCAGG 0: 1
1: 0
2: 0
3: 18
4: 185
1007909071_1007909078 27 Left 1007909071 6:45495007-45495029 CCATCTACAGTAGTCTCTGTCTG 0: 1
1: 0
2: 2
3: 15
4: 126
Right 1007909078 6:45495057-45495079 GCCACTGTGTTATCTTCTTCAGG 0: 1
1: 0
2: 0
3: 18
4: 185
1007909070_1007909078 28 Left 1007909070 6:45495006-45495028 CCCATCTACAGTAGTCTCTGTCT 0: 1
1: 0
2: 0
3: 11
4: 146
Right 1007909078 6:45495057-45495079 GCCACTGTGTTATCTTCTTCAGG 0: 1
1: 0
2: 0
3: 18
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007909078 Original CRISPR GCCACTGTGTTATCTTCTTC AGG Intronic
903397045 1:23009605-23009627 GCCACTGTGTTAGGTGCTACGGG + Intergenic
905961985 1:42050670-42050692 GTCACTGGGTCACCTTCTTCTGG + Intergenic
906010139 1:42515513-42515535 GACACTGTGTTCATTTCTTCTGG + Intronic
908640119 1:66213181-66213203 GCCACTGTAATATCATCTCCAGG - Intronic
910495578 1:87823721-87823743 CCCACTGTTTTATTTTCTTTAGG + Intergenic
911043143 1:93607745-93607767 CCTACAGTGTTATCTCCTTCAGG + Intronic
912706991 1:111922009-111922031 GCCACGGTGTTCTCTTCTCAAGG + Intronic
917669127 1:177256186-177256208 CCAACAGTCTTATCTTCTTCCGG + Intronic
918084121 1:181230707-181230729 GCTAATGTGTTTTCTTCTACTGG - Intergenic
918596040 1:186294368-186294390 GCCAATATGTTTTCTTCTCCTGG - Intergenic
919526344 1:198656824-198656846 GCCACAGTTTTATCTCCATCTGG - Intronic
1063722982 10:8603148-8603170 CCCAGTCTGTTATGTTCTTCTGG + Intergenic
1071249647 10:83803936-83803958 GCCTTGGTGTTATCTTCTTCTGG - Intergenic
1071822457 10:89292311-89292333 GGCACTGATTTGTCTTCTTCTGG + Intronic
1072724741 10:97805509-97805531 GATAGTGTGGTATCTTCTTCTGG + Intergenic
1072948597 10:99833157-99833179 CCCCCTGTGTCATCTTCCTCTGG + Intronic
1074940359 10:118230578-118230600 GTAACTTTGTTGTCTTCTTCAGG - Intergenic
1077429104 11:2507146-2507168 TCCACTGTGTTTTCTTCTGGAGG + Intronic
1077604206 11:3596609-3596631 GCCATTGCGATATCTTCTTTAGG + Intergenic
1078781846 11:14446259-14446281 GAGACTGTGTCATATTCTTCTGG - Intronic
1080181347 11:29430094-29430116 GTCACTGTGTCATCTTCTATTGG - Intergenic
1080780254 11:35422598-35422620 GACTCTGTGTTACCTTATTCTGG + Intergenic
1081328850 11:41779536-41779558 GACTCTGTGTTCTTTTCTTCTGG + Intergenic
1083096308 11:60254759-60254781 GCCACCGTGTTCTCCTCATCTGG + Intergenic
1084845642 11:71897437-71897459 GCCATTGTGATATCTTCTTTAGG - Intronic
1085142054 11:74154798-74154820 GCTATTCTTTTATCTTCTTCAGG - Intronic
1087088261 11:94242060-94242082 GCCTCTGTGCTATCATCCTCGGG - Intergenic
1088952320 11:114584328-114584350 GCCACTGTTTAATCTTCTCCAGG - Intronic
1089025683 11:115267415-115267437 GCCAGTGTGCTATCTCCTTGAGG + Intronic
1090592130 11:128283522-128283544 GCCAATGTTTTACCTTCTCCTGG + Intergenic
1092802337 12:12182076-12182098 ACCACTGTGTTATGTTTATCTGG - Intronic
1092893746 12:12993567-12993589 GCCACTGTGTTAGATACTTTGGG + Intronic
1092991182 12:13901264-13901286 GCCACTTAGACATCTTCTTCTGG + Intronic
1095680827 12:44973436-44973458 GGCACTGTGCTATGTACTTCAGG - Intergenic
1096456590 12:51792565-51792587 GCCACACTGTTTTCTGCTTCTGG - Intronic
1099252114 12:80269293-80269315 TCCATCATGTTATCTTCTTCAGG + Intronic
1099531009 12:83781355-83781377 TCCACTGTATCCTCTTCTTCTGG + Intergenic
1100925638 12:99544863-99544885 CCCTCAGTGTTTTCTTCTTCTGG + Intronic
1101850752 12:108400126-108400148 GCTACTGTGTTTTCTTGTTTAGG - Intergenic
1102947842 12:117005584-117005606 ACCTGTGTCTTATCTTCTTCCGG - Intronic
1104077697 12:125405060-125405082 GCCACTGTGTTAGCTTCCTGGGG + Intronic
1105535168 13:21259315-21259337 GCCACTGTGTGAGCTGCTACCGG + Intergenic
1107037068 13:35912736-35912758 GCCACTGTGATAGCTTTTTTTGG - Intronic
1111987393 13:95078916-95078938 GCCACTGTTTTATCTCCAACTGG + Intronic
1112989047 13:105488288-105488310 GATACTGTGTTATTTCCTTCTGG - Intronic
1117211245 14:53502722-53502744 GCCCCTGTGTTTTGTTTTTCAGG - Intergenic
1119804745 14:77475419-77475441 CCCACTGAGATATCTGCTTCGGG + Exonic
1121160715 14:91737192-91737214 GCCACTGTTTTCTCTTGTTTTGG - Intronic
1125928582 15:43583662-43583684 AACACTGTCTTATCTTCTTAGGG + Intronic
1125941748 15:43683497-43683519 AACACTGTCTTATCTTCTTAGGG + Intergenic
1130084270 15:80764197-80764219 ATCACTGTCTTGTCTTCTTCTGG - Intergenic
1131003740 15:88959093-88959115 GTAACTTTGTTAGCTTCTTCAGG - Intergenic
1131507037 15:93028374-93028396 GACACAGTGTTATTTCCTTCAGG - Intergenic
1133206793 16:4238918-4238940 ACCACCGTGTTACCTTCTTGAGG + Intronic
1133887634 16:9845487-9845509 GCCACTTTGCTTTCTTCATCGGG + Intronic
1134309510 16:13062906-13062928 GCCACTGTGGTCTCTCCCTCGGG - Intronic
1134901104 16:17938761-17938783 GCCAATGAGTTATCTTCTTTGGG + Intergenic
1135390154 16:22085821-22085843 CCCACAGTGTTTTCTTCTCCTGG - Intronic
1140157173 16:72443082-72443104 GCTACTGTGTCCTTTTCTTCTGG - Intergenic
1145197748 17:20909625-20909647 GTGACTGTGTTATGTTTTTCTGG + Intergenic
1146382867 17:32344316-32344338 GCCACTGTATTAGTTTCTTATGG - Intronic
1148638616 17:49168383-49168405 GGGAGTGAGTTATCTTCTTCTGG + Intronic
1148982926 17:51594844-51594866 GTGTCTGTGTTATCTGCTTCTGG + Intergenic
1150874389 17:68952977-68952999 TGCACTGAATTATCTTCTTCTGG - Intronic
1152539928 17:80969732-80969754 GCCTCTTGGCTATCTTCTTCCGG - Intergenic
1153332510 18:3888228-3888250 GACATTGAGTTATCATCTTCAGG - Intronic
1155507156 18:26545666-26545688 GACACTGTGTTCTATTCTGCAGG - Intronic
1155837401 18:30603285-30603307 GCCACTCTTTTATCTTATTATGG - Intergenic
1157865963 18:51185014-51185036 GCCACTGTGGTAACTTGTTAAGG - Intronic
1158236112 18:55316233-55316255 TCCACTGTATTTTCTTCTTAAGG + Intronic
1159277381 18:66238145-66238167 GCTACAGTGTAATCTTTTTCAGG - Intergenic
1159395393 18:67848705-67848727 GCCACTCTGTCATTTTCTTGGGG - Intergenic
1159548685 18:69872222-69872244 GCTAAAGTGTTATCTTCTTAGGG - Intronic
1160052790 18:75452077-75452099 GCCACTTTGTTATCTCTTTGGGG + Intergenic
1160144731 18:76354347-76354369 GCCACTGTGTTGTCCACCTCTGG + Intergenic
1164526202 19:29015350-29015372 CCCACTGTGTTCTCTCCTGCGGG + Intergenic
925892090 2:8442704-8442726 GGCACTTTGTTATCTGCTTCTGG - Intergenic
926114906 2:10206591-10206613 TTCACTGTCTTATCTTCTTCTGG - Intronic
927865218 2:26583656-26583678 GCCAATGTGTCATCTGCCTCAGG + Intronic
929292117 2:40205069-40205091 GCCACTGTTCTTTCATCTTCAGG - Intronic
929630543 2:43456477-43456499 GCCACTGTGTGGTATTCCTCTGG - Intronic
931019995 2:58033382-58033404 GCCAATGTTATAACTTCTTCCGG - Exonic
931085753 2:58828973-58828995 GCCATTTTGTTATTTGCTTCTGG + Intergenic
932900851 2:75698029-75698051 GCCACTGTGTTACTTTCCTGTGG - Intronic
936983188 2:118283370-118283392 CCCATTGTTTTATCTTCTTCTGG - Intergenic
938374416 2:130796381-130796403 GCCTCTGTCATATATTCTTCTGG - Intergenic
939633142 2:144549871-144549893 GCCACTGCCTTCTCTCCTTCGGG + Intergenic
942381390 2:175395094-175395116 GCCGCTGTCTGATCTTCTTTGGG - Intergenic
942954202 2:181755139-181755161 GGCACTGTGTGATCCTCCTCTGG + Intergenic
943295991 2:186139855-186139877 GCCAGTGTGTTTTCTACATCAGG + Intergenic
945036293 2:205706757-205706779 GGTACTGAGTTATCTTCTTGGGG + Intronic
947283564 2:228483498-228483520 GTCTCTGTGTTATTTTTTTCAGG - Intergenic
1169158209 20:3352380-3352402 GGCACTGGGTTATCCCCTTCTGG + Intronic
1170549293 20:17462496-17462518 GCCTCTGTGTTATCCTAGTCAGG - Intronic
1172330477 20:34072601-34072623 GCCACTCTGTTCTCTTTCTCTGG - Intronic
1174890585 20:54387756-54387778 GCCATTGTTTTATGTGCTTCTGG + Intergenic
1175456466 20:59118807-59118829 GCCATTTGGTTAACTTCTTCAGG - Intergenic
1177129047 21:17234099-17234121 GCAACTGAGTTTTCTACTTCTGG + Intergenic
1178499224 21:33111832-33111854 GCTACTGTGTCTTTTTCTTCTGG - Intergenic
1180664335 22:17497913-17497935 GCCACTGAGTTTTATTTTTCAGG + Intronic
1181628750 22:24139216-24139238 GCCAAGCTGTTATCTTTTTCTGG + Intronic
1184026755 22:41863374-41863396 GCCAGTGTGTGATATTCTTCTGG + Intronic
1184578813 22:45398209-45398231 GCCACTGTGTTCCCCTCATCTGG + Intronic
950460222 3:13116879-13116901 ACCACTGTGTTTTCTTCTGTGGG - Intergenic
951265133 3:20556299-20556321 GCCAGGGTGTTATCTTCTCATGG + Intergenic
951478117 3:23130257-23130279 ACCACAGTGTAATGTTCTTCAGG + Intergenic
952761589 3:36919796-36919818 GCCACTGTGGTATCTTATTGTGG + Intronic
955133460 3:56192769-56192791 GCCAATGGGTCACCTTCTTCAGG - Intronic
955589870 3:60523623-60523645 GCCACTGTCTTGCCTTCCTCAGG - Intronic
956078324 3:65530333-65530355 GCCACTGTGCTATATGGTTCTGG - Intronic
956842339 3:73152256-73152278 GCCACTTTGTTCTCATCTTAAGG - Intergenic
957156272 3:76549335-76549357 GCCACTGTGGTCTGCTCTTCGGG - Intronic
958872749 3:99580316-99580338 CCCAGTGTGGTCTCTTCTTCTGG - Intergenic
959822488 3:110753029-110753051 GCCACTGAGTTATCTTATTGTGG + Intergenic
960294210 3:115923288-115923310 GCCAGTGTGTTCTCTTCTGGGGG + Intronic
964656764 3:159075838-159075860 ACCACTGTGTTACCTTCAACAGG - Intronic
965079014 3:164015031-164015053 TCCACTGTTTTTCCTTCTTCAGG - Intergenic
965510976 3:169567632-169567654 GCCACTGCGTCATCATCATCTGG - Intronic
968255572 3:197267118-197267140 TACACTATGTTATCTTCTTAAGG + Intronic
968781282 4:2583540-2583562 GCTACTGTCTTTGCTTCTTCGGG + Intronic
968987699 4:3886264-3886286 GCCATTGCTATATCTTCTTCAGG + Intergenic
969023343 4:4153443-4153465 GCCATTGCTATATCTTCTTCAGG + Intergenic
969469840 4:7381370-7381392 GACACAGTGTGCTCTTCTTCTGG - Intronic
969786642 4:9463269-9463291 GCCATTGTGATATCTTCTTTAGG - Intergenic
970140924 4:12981311-12981333 GCTACTGTAATATTTTCTTCTGG - Intergenic
971388302 4:26161633-26161655 GCCTCTGTGTGACCTACTTCTGG - Intergenic
974324532 4:60396582-60396604 GACAGTGTGTTGTCTTCCTCTGG + Intergenic
974843752 4:67326156-67326178 ACCATTATGTTATTTTCTTCTGG - Intergenic
975603715 4:76130554-76130576 GCTACTGTTTTATCTTAATCAGG - Intronic
975615580 4:76243544-76243566 GCAACTTTGTTTTCTACTTCAGG + Intronic
975868774 4:78754332-78754354 GGCACTGTGTTATGTACTTGAGG - Intergenic
976365908 4:84231754-84231776 CTCACTGTGTTATCTTCTTTAGG + Intergenic
980333659 4:131441064-131441086 GCCACTGTGTTGTGTTGCTCAGG + Intergenic
980437296 4:132794070-132794092 GCCAGTGTATTATCTTTTTGAGG - Intergenic
982012857 4:151123638-151123660 GACACTGTTTTATCTTCATCAGG + Intronic
982787779 4:159556485-159556507 TCCACTGGGTTGTCTTCTTTGGG + Intergenic
984121063 4:175745049-175745071 GACACTGTCTTATCTACTGCAGG + Intronic
985700725 5:1370504-1370526 GCCAGTGTTTGATGTTCTTCAGG + Intergenic
987863779 5:23515610-23515632 TCCTCTGTGTTTTCTTCTTGAGG + Intronic
988625034 5:32865795-32865817 GCCACCGTGTTGTCTTCCTGGGG + Intergenic
992520921 5:77550453-77550475 GCCACTTTTTTGTCTTCTTTTGG - Intronic
992634749 5:78716813-78716835 ACCACTGTGCTATATTCCTCAGG + Intronic
994694691 5:103059487-103059509 ACAACTGTGCTATCATCTTCAGG + Intergenic
995957487 5:117795509-117795531 GCCACTGAGTTATTTTATTGAGG - Intergenic
999848987 5:155517002-155517024 TCCACTGTATTAGCTTCTTAGGG + Intergenic
1000669081 5:164038177-164038199 GCCACTGTATGCTCTTCTGCAGG + Intergenic
1002953110 6:1835232-1835254 GTCCCTGTGTGCTCTTCTTCTGG - Intronic
1002958837 6:1895317-1895339 ACCTTTGTGTTATCTTCCTCTGG + Intronic
1007011276 6:38420292-38420314 GCCACTCTGTTGTTTTCTACTGG - Intronic
1007909078 6:45495057-45495079 GCCACTGTGTTATCTTCTTCAGG + Intronic
1008550556 6:52625679-52625701 GCCTCTGTGTTAGCTTTTTAAGG - Intergenic
1009582697 6:65557482-65557504 GCCACTGCGTTCTCCTCCTCTGG - Intronic
1012246951 6:96936894-96936916 CCCACTGTCTTACCTCCTTCGGG + Intronic
1015869269 6:137759682-137759704 GCCACTGTGTTGTCATGCTCTGG - Intergenic
1015989740 6:138925858-138925880 GCCTCTGTCTTGTCTTCTTGTGG - Intronic
1017323713 6:153122606-153122628 CCTACTGTCTTATTTTCTTCTGG - Intronic
1017644531 6:156526826-156526848 GCAAATGTGTTAGCTTCTTAAGG + Intergenic
1018441657 6:163819712-163819734 GCCATTCTCTTTTCTTCTTCCGG + Intergenic
1019058237 6:169237799-169237821 GCCACCGTGTTTGCTTCCTCTGG - Intronic
1020534776 7:9382896-9382918 GCCAGCGTCTTCTCTTCTTCTGG - Intergenic
1021808166 7:24377120-24377142 GCCACTGTATTAGCTTACTCAGG - Intergenic
1022749648 7:33211202-33211224 GCCATTTTGTTATTTTTTTCTGG + Intronic
1022907005 7:34867279-34867301 GCCACTTTGCCATCTTCTCCAGG - Intronic
1023682889 7:42706048-42706070 GGCACTGTGCTAACTTCTTGGGG - Intergenic
1027785643 7:82576103-82576125 GCCACAGTGTTTTCTTATTTGGG + Intergenic
1030371692 7:108707323-108707345 TCTTCTGTGTAATCTTCTTCGGG + Intergenic
1032596587 7:133247019-133247041 GCAACTGTTTTATTTTATTCAGG - Intergenic
1035004877 7:155649091-155649113 GCTACTTTGTTTTCTCCTTCTGG + Intronic
1036240633 8:7077990-7078012 GCCATTGTGATATCTTCTTTAGG - Intergenic
1036261422 8:7243587-7243609 GCCACTGCTATATCTTCTTTAGG + Intergenic
1036313462 8:7702131-7702153 GCCACTGCTATATCTTCTTTAGG + Intergenic
1039020750 8:33203292-33203314 GACACTTTGTTATCTTCTTTTGG - Intergenic
1040072144 8:43196926-43196948 CACACTGTGTTATCTCCTCCAGG + Exonic
1040440818 8:47439944-47439966 GCCACTGTGGATTCTTCTTAAGG - Intronic
1040803020 8:51364403-51364425 TCAATGGTGTTATCTTCTTCTGG - Intronic
1040892067 8:52327576-52327598 ACCACTGTTTTATGTTTTTCAGG + Intronic
1043124392 8:76371919-76371941 TACACTGTGTTTCCTTCTTCAGG - Intergenic
1049430619 8:142562163-142562185 TCCACTGTCTCCTCTTCTTCTGG + Intergenic
1050003486 9:1102865-1102887 GTCACTGTGTGCTCTTTTTCCGG - Intergenic
1055292396 9:74795949-74795971 GTCACTGTGTTGTCTTCTTGTGG - Intronic
1055983955 9:82036698-82036720 GCCACATGGTTATCTTCTTTGGG + Intergenic
1056054068 9:82802346-82802368 GTAACTCTGTTATCTTCTACTGG + Intergenic
1056295154 9:85185503-85185525 GCCATTATGTTGTCTTCCTCCGG + Intergenic
1060368139 9:123040930-123040952 GCCACTGGGTTATCTATTTATGG + Intronic
1061091556 9:128429235-128429257 GCCACTGTGCTCTCCTCCTCTGG - Intronic
1062092998 9:134688380-134688402 GGCACTGTGTCATCTTCAGCAGG + Intronic
1187799058 X:23039987-23040009 GCCACTGTCTTTTCCTCCTCAGG - Intergenic
1191934411 X:66411016-66411038 ACCCCTGAGTCATCTTCTTCAGG + Intergenic
1192049845 X:67714711-67714733 GCCACTGTGTTAGGCTGTTCTGG - Intronic
1193693464 X:84677903-84677925 GCCACTTTGTTATTTTTTTCTGG + Intergenic
1194035490 X:88865650-88865672 CCCACTGTGTTAGCTTGTTAGGG + Intergenic
1195822578 X:108962879-108962901 GCCACTATTTTATCCTCCTCAGG + Intergenic
1198674202 X:139114527-139114549 GCCCATGTGTTATCTCCTCCAGG - Intronic
1199484724 X:148335157-148335179 GTCACAGTCTTTTCTTCTTCAGG + Intergenic
1200686230 Y:6262828-6262850 GGCAATGTTTTATTTTCTTCAGG - Intergenic
1200989113 Y:9333744-9333766 GGCAATGTTTTATTTTCTTCAGG - Intergenic
1200991770 Y:9354074-9354096 GGCAATGTTTTATTTTCTTCAGG - Intergenic
1200994424 Y:9374354-9374376 GGCAATGTTTTATTTTCTTCAGG - Intronic
1200997087 Y:9394700-9394722 GGCAATGTTTTATTTTCTTCAGG - Intergenic
1200999603 Y:9463238-9463260 GGCAATGTTTTATTTTCTTCAGG - Intergenic
1201002261 Y:9483546-9483568 GGCAATGTTTTATTTTCTTCAGG - Intronic
1201004920 Y:9503833-9503855 GGCAATGTTTTATTTTCTTCAGG - Intergenic
1201007578 Y:9524160-9524182 GGCAATGTTTTATTTTCTTCAGG - Intergenic
1201010208 Y:9544350-9544372 GGCAATGTTTTATTTTCTTCAGG - Intergenic