ID: 1007910188

View in Genome Browser
Species Human (GRCh38)
Location 6:45505683-45505705
Sequence GGGTGCTCAAAAATGCTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 71}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007910188_1007910199 30 Left 1007910188 6:45505683-45505705 CCAACTAGCATTTTTGAGCACCC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 1007910199 6:45505736-45505758 ATGTTTTGTGGTTTATAGGATGG 0: 1
1: 0
2: 1
3: 19
4: 277
1007910188_1007910198 26 Left 1007910188 6:45505683-45505705 CCAACTAGCATTTTTGAGCACCC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 1007910198 6:45505732-45505754 TTTTATGTTTTGTGGTTTATAGG 0: 1
1: 0
2: 8
3: 112
4: 1226
1007910188_1007910197 18 Left 1007910188 6:45505683-45505705 CCAACTAGCATTTTTGAGCACCC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 1007910197 6:45505724-45505746 TTCTGTGCTTTTATGTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007910188 Original CRISPR GGGTGCTCAAAAATGCTAGT TGG (reversed) Intronic
902187629 1:14737222-14737244 GGGTGCTCCAACATGCAAGGAGG + Intronic
902605555 1:17567176-17567198 AGGTGCCCAAAAATGCTAGCTGG - Intronic
910466382 1:87504757-87504779 AGGTGCTCAAAAATATTTGTTGG + Intergenic
921827489 1:219689800-219689822 AAGTGTTCAAAAATGCTTGTAGG - Intronic
1063927543 10:10995353-10995375 AGGTGCTCAAAAATACTGGCTGG - Intergenic
1068159565 10:53246574-53246596 TGCTGTTCAAAAATTCTAGTTGG + Intergenic
1073540489 10:104313301-104313323 AGGTGCTCAAAAATGCTACCCGG - Exonic
1073657783 10:105435815-105435837 GGGTGATGAAAAATCCTTGTTGG - Intergenic
1084035916 11:66510355-66510377 TGCTGCTCATAAATGCTAGAAGG + Intronic
1085842452 11:80028316-80028338 GGATGCTCACAAATTCTTGTTGG + Intergenic
1093244295 12:16716821-16716843 GGGTGAACAAAAATGCTGATTGG + Intergenic
1095437406 12:42205835-42205857 GGATGCACAAAAATGGTACTTGG - Intronic
1101216174 12:102586402-102586424 GGGTGTTCAAAAATTCCAGCTGG - Intergenic
1104664284 12:130636285-130636307 TGGTGCTCAAGAGTGCCAGTAGG - Intronic
1106148623 13:27075723-27075745 GGGTGCTCAAGAGTGGTAGAGGG + Intronic
1108179599 13:47827751-47827773 GGGAGTTGAAAAATGTTAGTGGG - Intergenic
1112628631 13:101136162-101136184 TGGTCCTCAAAAATGATTGTTGG + Intronic
1113097463 13:106680789-106680811 GGGTGTTAAAAAAGGCAAGTAGG + Intergenic
1118752665 14:68817996-68818018 AGGTGCTTAAAAATGCTCATTGG - Intergenic
1120374944 14:83692383-83692405 GTGTTCTCAAAATTGCTAATGGG - Intergenic
1126484217 15:49161340-49161362 AGGTGCTAATAAGTGCTAGTTGG + Intronic
1127209691 15:56760411-56760433 GGGAGCTCAAACATGCTTGAAGG + Intronic
1135463308 16:22663803-22663825 GGGTTCTCAGAAACACTAGTAGG + Intergenic
1139275866 16:65727134-65727156 TGGAGCTCAAAACTGCCAGTTGG - Intergenic
1140834994 16:78785301-78785323 GGGTGCTCAAAGCTGCTGCTGGG - Intronic
1144227397 17:13162948-13162970 TGGTTATCTAAAATGCTAGTTGG - Intergenic
1147728946 17:42585023-42585045 GGGTCCTCAAAAGTGGAAGTCGG - Intronic
1149474944 17:56952975-56952997 GAGTACTCAAAAATGCCTGTTGG + Intronic
1151835265 17:76578717-76578739 GGGTGCTCAAAACTGCCACAGGG + Intronic
1152729844 17:81964247-81964269 GGGTGCTCAAAACTCCGGGTGGG - Intergenic
1153750074 18:8220307-8220329 GCATGCTCAAAAAAGCAAGTTGG - Intronic
1159506954 18:69351046-69351068 GGGTGCTCAAAAATATTTATTGG + Intergenic
1167427324 19:49436224-49436246 GCGTGAGCAAAATTGCTAGTAGG + Intronic
927625382 2:24711539-24711561 GGCTTCTCAAAACTGCTAATAGG - Intronic
931815520 2:65896940-65896962 AGGTGCTCAAAAATGTTAACTGG + Intergenic
933259173 2:80112728-80112750 GGGTGCGCAAAAATGCAGGTAGG - Intronic
935105127 2:100035494-100035516 GGCTGATCAAAAAAGTTAGTAGG - Intronic
936666127 2:114597892-114597914 GTGTGGTCAAAAATGATGGTGGG - Intronic
936824276 2:116561859-116561881 GGATCCTCAAAAAAGCTATTCGG + Intergenic
940158288 2:150682557-150682579 GGGGGCTCAAAAAAGTTAGCAGG + Intergenic
1175684021 20:61013914-61013936 GAGTTCTCAAAAGAGCTAGTTGG - Intergenic
1176194158 20:63829629-63829651 AGGTGCCCAAAAGTGCCAGTTGG + Intronic
1177960443 21:27660120-27660142 GTGTTTGCAAAAATGCTAGTAGG - Intergenic
1180598245 22:16993952-16993974 GGGTGTTCACAAATGCAAGAAGG - Intronic
1183084312 22:35477261-35477283 GGGGGCTCTAAAACGCTGGTTGG - Intergenic
1184047243 22:41979107-41979129 GGGTGCTCATATGTGCTTGTTGG + Intronic
949681146 3:6515855-6515877 GGGTGCTGAAAAAATATAGTGGG - Intergenic
950141603 3:10619844-10619866 GGGTGCACACAGATGCTAGTGGG + Intronic
950699011 3:14727241-14727263 GAGAGCTCAGAAATGCAAGTGGG - Intronic
950753991 3:15156940-15156962 CTATGCTCAATAATGCTAGTAGG - Intergenic
954327656 3:49872410-49872432 GGGTCCTCATAAAGGCTACTAGG - Intergenic
955790594 3:62585147-62585169 GTGTGTCCAAAACTGCTAGTTGG + Intronic
957343985 3:78938879-78938901 GGGTGTTCAACAATGCGAGGTGG + Exonic
958501663 3:94918615-94918637 AGGTGCTCAAAAATATTAGTAGG - Intergenic
965264630 3:166526004-166526026 AGATGCTAAAAAATGGTAGTTGG + Intergenic
971250220 4:24968204-24968226 GGGTGCTTGAAAATGCTAGGAGG + Intronic
971505120 4:27358310-27358332 GGGTGCTCTAAGTTGCTAGTGGG + Intergenic
981340182 4:143613049-143613071 AGTTGCTAAAAAATGATAGTGGG + Intronic
981794183 4:148576878-148576900 GGATTCTCAAAAAAGCTTGTTGG + Intergenic
987508075 5:18798915-18798937 GGGTACAAAAAAATTCTAGTCGG + Intergenic
987522744 5:19007986-19008008 AGGTGTTCAAAAATGCTCATTGG + Intergenic
992888773 5:81185099-81185121 GGGTGATCACAATTGCTAGCAGG - Intronic
1001162213 5:169330115-169330137 GGGTCCTTAAAAATGGTAGCGGG - Intergenic
1001727770 5:173921496-173921518 GGAAGCTCCAAAATGCTACTTGG - Intronic
1007910188 6:45505683-45505705 GGGTGCTCAAAAATGCTAGTTGG - Intronic
1008106135 6:47442768-47442790 GGGTGTTTAAACATGCTAGGTGG - Intergenic
1008842211 6:55916393-55916415 GCATGCTCAAAAATCCTGGTAGG - Intergenic
1012939008 6:105398017-105398039 GGATGGACAAAAATGCTAATTGG + Intronic
1023468235 7:40482970-40482992 GAGAGCTCATAAATGCTAGGGGG + Intronic
1033011165 7:137624512-137624534 GGGCGCTGAAAAATGCCATTGGG - Intronic
1034082960 7:148297544-148297566 GGGTGCTAGAAAGTGCTATTCGG + Intronic
1036477175 8:9103915-9103937 AGGTGCTCACAATTGCTAGAAGG - Intronic
1041256198 8:55981374-55981396 AGATGCTCAAAAATGCTTGTTGG + Intronic
1041476837 8:58276850-58276872 GGGATCTCAAGAATGTTAGTTGG + Intergenic
1042430752 8:68703699-68703721 GGCTCCTCAAAAATTCTTGTGGG + Intronic
1059629802 9:116109023-116109045 GGGAGCTCTAAAATGATATTTGG - Intergenic
1187263796 X:17712081-17712103 GAATGCTCATAAATGCTGGTGGG - Intronic
1193499145 X:82251767-82251789 GGGTGCTGACAAAAGCTGGTGGG + Intergenic
1196117856 X:112016509-112016531 GGGTGCTCAGAAAGCATAGTTGG + Intronic
1197378103 X:125707087-125707109 GGGTGGACAAAAATCCAAGTAGG - Intergenic