ID: 1007910188

View in Genome Browser
Species Human (GRCh38)
Location 6:45505683-45505705
Sequence GGGTGCTCAAAAATGCTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 71}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007910188_1007910198 26 Left 1007910188 6:45505683-45505705 CCAACTAGCATTTTTGAGCACCC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 1007910198 6:45505732-45505754 TTTTATGTTTTGTGGTTTATAGG 0: 1
1: 0
2: 8
3: 112
4: 1226
1007910188_1007910199 30 Left 1007910188 6:45505683-45505705 CCAACTAGCATTTTTGAGCACCC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 1007910199 6:45505736-45505758 ATGTTTTGTGGTTTATAGGATGG 0: 1
1: 0
2: 1
3: 19
4: 277
1007910188_1007910197 18 Left 1007910188 6:45505683-45505705 CCAACTAGCATTTTTGAGCACCC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 1007910197 6:45505724-45505746 TTCTGTGCTTTTATGTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007910188 Original CRISPR GGGTGCTCAAAAATGCTAGT TGG (reversed) Intronic