ID: 1007910198

View in Genome Browser
Species Human (GRCh38)
Location 6:45505732-45505754
Sequence TTTTATGTTTTGTGGTTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1347
Summary {0: 1, 1: 0, 2: 8, 3: 112, 4: 1226}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007910194_1007910198 4 Left 1007910194 6:45505705-45505727 CCCTGGGTACGGTTTTGCCTTCT 0: 1
1: 0
2: 0
3: 14
4: 127
Right 1007910198 6:45505732-45505754 TTTTATGTTTTGTGGTTTATAGG 0: 1
1: 0
2: 8
3: 112
4: 1226
1007910188_1007910198 26 Left 1007910188 6:45505683-45505705 CCAACTAGCATTTTTGAGCACCC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 1007910198 6:45505732-45505754 TTTTATGTTTTGTGGTTTATAGG 0: 1
1: 0
2: 8
3: 112
4: 1226
1007910192_1007910198 6 Left 1007910192 6:45505703-45505725 CCCCCTGGGTACGGTTTTGCCTT 0: 1
1: 0
2: 0
3: 9
4: 65
Right 1007910198 6:45505732-45505754 TTTTATGTTTTGTGGTTTATAGG 0: 1
1: 0
2: 8
3: 112
4: 1226
1007910195_1007910198 3 Left 1007910195 6:45505706-45505728 CCTGGGTACGGTTTTGCCTTCTG 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1007910198 6:45505732-45505754 TTTTATGTTTTGTGGTTTATAGG 0: 1
1: 0
2: 8
3: 112
4: 1226
1007910187_1007910198 27 Left 1007910187 6:45505682-45505704 CCCAACTAGCATTTTTGAGCACC 0: 1
1: 0
2: 1
3: 11
4: 127
Right 1007910198 6:45505732-45505754 TTTTATGTTTTGTGGTTTATAGG 0: 1
1: 0
2: 8
3: 112
4: 1226
1007910193_1007910198 5 Left 1007910193 6:45505704-45505726 CCCCTGGGTACGGTTTTGCCTTC 0: 1
1: 0
2: 0
3: 7
4: 77
Right 1007910198 6:45505732-45505754 TTTTATGTTTTGTGGTTTATAGG 0: 1
1: 0
2: 8
3: 112
4: 1226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007910198 Original CRISPR TTTTATGTTTTGTGGTTTAT AGG Intronic
900840390 1:5044659-5044681 ATTTATGTATTTTGGTTTTTGGG + Intergenic
902419122 1:16263745-16263767 TGTTTTGTTTTTTGGTTTTTCGG - Intronic
902706031 1:18205219-18205241 TTCTCTGTGTAGTGGTTTATGGG + Intronic
903729556 1:25481922-25481944 TTTTATGATTTGGGGTTTTGGGG + Intronic
903980802 1:27186719-27186741 TTTTAGGAGTTTTGGTTTATGGG + Intergenic
904067453 1:27764924-27764946 TTTTTTGTTTTTTGTTTTTTTGG + Intergenic
904232258 1:29085488-29085510 TTTAATGTTTTCTGATTTAGAGG - Intronic
904574480 1:31495179-31495201 TTTTTTGTTTTGTTGTGTTTTGG + Intergenic
904832841 1:33316452-33316474 TTTTTTGTTTGTTGGTTTTTGGG - Intronic
905081318 1:35323527-35323549 TTTTTTGTTTTTTGTTTTTTTGG + Intronic
905562184 1:38936295-38936317 TTTTTTGTTTGTTGGTTTTTGGG + Intronic
905570382 1:38999875-38999897 TTTTTTGTTTTTTGTTTTTTTGG + Intronic
905848480 1:41255310-41255332 TTTTATGTTTTCTGTTTCCTTGG + Intergenic
906029175 1:42703809-42703831 TTTTCTGACTTGTGGTTTATGGG + Intergenic
906494375 1:46293553-46293575 TTTTACTTTTTTTTGTTTATTGG + Intronic
906769852 1:48474328-48474350 TGTTTTGTTTTGGGGTTTTTTGG + Intergenic
906881044 1:49591171-49591193 TATTTTGTTTTGTGTTTTTTTGG - Intronic
907055687 1:51365554-51365576 TTTTATGTTCTGAGGTTGTTAGG - Intronic
907347002 1:53790379-53790401 TTTTATTTATTTTGGTTTTTTGG - Intronic
907601731 1:55778172-55778194 TTATATGTTTTGGGGTTTTGTGG - Intergenic
907697609 1:56749057-56749079 TTTTTTTTTTTGTGGGTGATTGG + Intronic
907797767 1:57734373-57734395 TTTTATGATTTGTGGCTTATTGG - Intronic
907879319 1:58530451-58530473 TCTTATGTTTTCTCGTTTTTAGG - Intronic
907977946 1:59451098-59451120 TTTTGTTTTGTGTGGTTTATTGG + Intronic
908183314 1:61627407-61627429 ATTTGTGTTTTGGGGTTTGTGGG - Intergenic
908292205 1:62679245-62679267 TTTAATGGTTATTGGTTTATGGG - Intronic
908872547 1:68630315-68630337 TTTTCTGTTTTTTTGTTTTTTGG - Intergenic
909098456 1:71319886-71319908 TTTTATTTTTTGTAAGTTATTGG + Intergenic
909107992 1:71436824-71436846 TTTTATTTTCTCTAGTTTATTGG + Intronic
909236403 1:73157683-73157705 TTTTTTGTTTTTTGGATAATAGG - Intergenic
909285378 1:73809802-73809824 TTTTTTTTTTTTTGGTTGATAGG + Intergenic
909317535 1:74242643-74242665 TTTTTTGTTTTGTGGCTAATTGG - Intronic
909576145 1:77178633-77178655 TTTTAGGTGATTTGGTTTATGGG + Intronic
910036571 1:82796207-82796229 TTTTAGGTTTTTTGGTGTAGGGG - Intergenic
910077926 1:83302218-83302240 TTTTAGATTTTCTAGTTTATGGG - Intergenic
910209706 1:84780406-84780428 GTTTTTGTTTTGTTTTTTATGGG - Intergenic
910451520 1:87351457-87351479 TTTTTTGTTTTTTGTTTTTTTGG + Intergenic
910488563 1:87742911-87742933 TTTTATGTTTTGTCTTTTTTTGG + Intergenic
910559831 1:88578490-88578512 TTTCATGCTTTCTGGTATATAGG - Intergenic
910704701 1:90116236-90116258 TTCTATTTTTTGTGTTTTATGGG + Intergenic
910749318 1:90611455-90611477 TTTCAGGTTTTGTGGTCCATAGG - Intergenic
910770923 1:90831768-90831790 TTTTTTGTTTTGTTTTTTAAGGG + Intergenic
910952253 1:92662562-92662584 TTTTATGTTCTGTGATATTTAGG - Intronic
910960336 1:92755429-92755451 TTTTTTGTTTTTGGGTTTTTTGG - Intronic
911076181 1:93877965-93877987 TTTTTTGTTTTTTGTTTTAAAGG - Intronic
911179738 1:94849748-94849770 TTTTGTGTTTTGTTTTTTGTTGG + Intronic
911331777 1:96532736-96532758 TTTTCTGTTTTTTGTTTTTTTGG + Intergenic
911859057 1:102923307-102923329 TTTTATTTTTGGTGTTTGATGGG - Intronic
911903516 1:103535308-103535330 TTAAATGTTTTTTGTTTTATAGG + Exonic
911948360 1:104139336-104139358 CTTTCTGTGTTGTGGTATATTGG + Intergenic
912266390 1:108161558-108161580 TTTTGTGTTTTGTAGCTCATTGG - Intronic
912782104 1:112560401-112560423 GTTTTTGTTTTTTGGTTTTTGGG - Intronic
912804775 1:112746712-112746734 TTTTATGGTTTGTGATTTTGAGG + Intergenic
913109527 1:115645025-115645047 CATGATGTTTGGTGGTTTATAGG + Intronic
913147323 1:116005155-116005177 TTTTCTGTTTTGAATTTTATTGG + Intronic
913323819 1:117608834-117608856 ACTTATGTTTTGGGGTTTCTTGG + Intronic
913379988 1:118199953-118199975 TTTTTTTTTTTCTGGTGTATTGG + Intergenic
913519030 1:119628361-119628383 CTTTCTGATTTGTGATTTATTGG + Intronic
914774291 1:150721743-150721765 TATTATGTTGTTTGCTTTATTGG - Intergenic
914817784 1:151075732-151075754 TGTTTTGTTTTGTGTTTTTTTGG - Intronic
915061041 1:153185344-153185366 TTTTTTTTTTTGTGGTTAGTAGG + Intergenic
915387488 1:155509163-155509185 TTTTAAGTATTTTGTTTTATAGG - Intronic
915459077 1:156059005-156059027 TTTTGTTTTTTGTGTTTTTTAGG + Intergenic
915865880 1:159498718-159498740 TTTTATATTCTGTGATTTAATGG + Intergenic
916511010 1:165472355-165472377 TTTTATTTTTTGTTTTTTTTGGG - Intergenic
916626129 1:166557296-166557318 TTTTAGGTATTTTGGTTTATGGG + Intergenic
916902043 1:169236728-169236750 TTTTTTCTTTTTTGGCTTATTGG + Intronic
917396269 1:174597475-174597497 TTCTAGGTTTTCTGATTTATTGG + Intronic
917502814 1:175600817-175600839 TTTTCTGTTTTTTGCTTTTTGGG - Intronic
917909547 1:179628638-179628660 TGTTATGCTTTCTGCTTTATTGG - Intronic
918465339 1:184816155-184816177 TTTTAGGTGATTTGGTTTATGGG + Intronic
918637992 1:186802673-186802695 TTTTTTTTTTTTTGGTTTACTGG - Intergenic
919404151 1:197155356-197155378 TTTTATTTTTTTTTGGTTATGGG - Exonic
919486523 1:198154607-198154629 TTTTTTGTTTTTTGTTTTTTTGG - Intergenic
919521540 1:198595499-198595521 TTTTTTGTTTTGTTTTTTTTTGG + Intergenic
919533204 1:198751527-198751549 TTTTATGTTTTTTGTTTTAAAGG + Intronic
919544578 1:198899225-198899247 TTTAATGTGTTGTGCTCTATGGG - Intergenic
920082412 1:203384788-203384810 TTTTAGGTTTTGTGGTCCAGGGG + Intergenic
920727682 1:208451626-208451648 TTTTTGGTTTTTTGGTTTTTTGG + Intergenic
920885719 1:209926006-209926028 TTTTATGTTTGTTTGTTTTTTGG - Intergenic
920887381 1:209943212-209943234 TTTTATTTTTTGTTGTTTTAAGG + Intronic
921090564 1:211838256-211838278 TTTTTTGTTTTTTGTTTTTTTGG + Intergenic
921121987 1:212145354-212145376 TTTTTGGTTTTTTGGTTTTTTGG + Intergenic
921210079 1:212887907-212887929 GTTTATATTTTGTCTTTTATTGG + Exonic
921461994 1:215439155-215439177 TTTTATGTTTTTTGACTTACAGG + Intergenic
921568703 1:216752410-216752432 TTTTATTTTTTGTTCTTTAGAGG - Intronic
921772839 1:219062568-219062590 TTTTTTGGTTTTTGGTTTTTGGG + Intergenic
921967906 1:221111639-221111661 TTTTCTGTTTTCTGTTTCATTGG + Intergenic
922135991 1:222826705-222826727 TTTAATGATTTGTGGTTGTTTGG + Intergenic
922187683 1:223290321-223290343 CTTTATTCTATGTGGTTTATAGG - Intronic
922237065 1:223730001-223730023 TTTTTTTTTTTTTGGTTTTTTGG - Intronic
922322071 1:224497645-224497667 TTTTATGTGTTGCTGTTTGTTGG + Intronic
922491415 1:226019998-226020020 TTTTATGTTTAGTGAATTATTGG + Intergenic
922758998 1:228113219-228113241 TTTTAGGTGGTTTGGTTTATGGG - Intergenic
922919306 1:229288107-229288129 GGTTTTGTTTTGGGGTTTATTGG + Intronic
923167319 1:231378259-231378281 TTTCAGGCTTTCTGGTTTATAGG - Intronic
924350787 1:243112734-243112756 TTTTATTTTTTATTGTTAATAGG + Intergenic
924753947 1:246924758-246924780 TTTTAGGTTTTGTGACTTAATGG - Intronic
1063370935 10:5522916-5522938 TTTTTTATTTTGGGGTTTTTTGG - Intergenic
1063378490 10:5569259-5569281 TTGGATGGTTAGTGGTTTATAGG + Intergenic
1063871037 10:10418007-10418029 TTTTATCTTTTATGCTTTATTGG + Intergenic
1064361346 10:14668032-14668054 TTTTTTGTTTTTTGTTTTTTGGG + Intronic
1064784756 10:18881574-18881596 TATTATGTTTTCTTGTATATGGG + Intergenic
1065003435 10:21358114-21358136 TTTTTGGTTTTTTGGTTTTTTGG + Intergenic
1065139877 10:22710054-22710076 TTTTTTTTTTTTTGGTTCATGGG - Intronic
1065807192 10:29404990-29405012 TTTTATGTGGTTTGGTTTATGGG - Intergenic
1066143848 10:32535979-32536001 ATTTAGATTTTATGGTTTATAGG + Intronic
1066260929 10:33729039-33729061 TTTTATGTTTTCAGGTTTTTTGG - Intergenic
1066353138 10:34656166-34656188 TTACAATTTTTGTGGTTTATGGG - Intronic
1068238203 10:54265956-54265978 ATATATATTTTGTGGTTTGTTGG - Intronic
1068373253 10:56146778-56146800 TTTTATTTATTGTTGTTTTTTGG + Intergenic
1068494565 10:57770556-57770578 ATATATATTTTGTGGTTGATGGG - Intergenic
1068862662 10:61863554-61863576 TTTTTTTTTTTGTAGTTCATGGG - Intergenic
1068890409 10:62142751-62142773 TTTGGTGCTTTCTGGTTTATGGG - Intergenic
1068941886 10:62688750-62688772 TTTTTTCTTTTGAGGCTTATGGG - Intergenic
1069522352 10:69133651-69133673 TTTTTTGTTTTGGGTTTTTTGGG + Intronic
1070189917 10:74102727-74102749 TTTTATGTTCCATGTTTTATGGG - Intronic
1070371060 10:75782466-75782488 ATTTCTGTTTTGTTTTTTATGGG + Intronic
1070523964 10:77279022-77279044 TTTTTTGTTTTTAGGTTTTTGGG + Intronic
1071213561 10:83372524-83372546 TTTGATGTGTTGTAGTTTACTGG + Intergenic
1071310439 10:84338317-84338339 TTTTTTGGTTTGTTGTTTTTGGG - Intronic
1071404361 10:85315869-85315891 TTTTCTGTTTCCTGGTTTAGTGG - Intergenic
1072382102 10:94883502-94883524 TTTTTTTTTTTGTTGTTTATTGG - Intergenic
1072839594 10:98756683-98756705 TTTTTTGTTTTTTGGTTGGTAGG - Intronic
1072848202 10:98856023-98856045 TTTTATGGTTTGGATTTTATTGG - Intronic
1072878019 10:99194632-99194654 TTTTAGGTTTTCCAGTTTATTGG - Intronic
1072892588 10:99337567-99337589 TTTTGTATTTTGGGGTTTACAGG - Intronic
1073355535 10:102850954-102850976 TGTTTTGTTTTGTTGTTTTTTGG - Intergenic
1073408862 10:103322918-103322940 GTGTATGTTTTGTGTTTTGTGGG - Intronic
1073856225 10:107677076-107677098 TTTTATATTTTTTGGGTTAGTGG + Intergenic
1074440816 10:113476036-113476058 TTTTTTGTTTTTTGTTTTTTGGG + Intergenic
1074478119 10:113791393-113791415 TGTTTTGTTTTGGGGTTTCTTGG + Intergenic
1074487049 10:113895225-113895247 TTTCTTTTTTTGTGGTTTCTAGG + Intronic
1074770070 10:116727756-116727778 TTTTTTTTTTTTTGGTTTTTTGG + Intronic
1074986080 10:118660994-118661016 CATTATGTTATGTGTTTTATAGG + Intergenic
1075036204 10:119069729-119069751 TTTTATGTTTTCTGTGTTGTAGG - Intronic
1075150267 10:119922998-119923020 TTTTTTGTTTTTTTTTTTATAGG - Intronic
1075246959 10:120831137-120831159 TTGTATGTTGTGTGGTTTCATGG - Intergenic
1075760504 10:124852183-124852205 TTTTATGTTTTGTAATCTAAAGG + Intergenic
1075912926 10:126141405-126141427 TTTTCTGTGTTGTGTTTTGTTGG - Intronic
1076012443 10:127001139-127001161 TTTTAATTTTTGTGATTTTTGGG + Intronic
1076256182 10:129026379-129026401 TTTTATTTTTTTGGCTTTATTGG - Intergenic
1076400969 10:130185063-130185085 TATTATGTTTTGTGCTTAAAAGG + Intergenic
1076758033 10:132584979-132585001 TTTTCTGTTTTCTGTTTTCTTGG + Intronic
1076910129 10:133383626-133383648 TTTTTTGTTTTTTTGTTTTTTGG - Intronic
1077062190 11:622446-622468 GTTTTTGTTTTTTGGTTTTTGGG + Intronic
1077829355 11:5847929-5847951 TTTTTTTTTTTTTGGCTTATGGG + Intronic
1078504762 11:11927298-11927320 TGTTTTGGTTTTTGGTTTATTGG + Intronic
1078624995 11:12947284-12947306 TTTTAGGTTTTGTGAGCTATAGG - Intergenic
1079456549 11:20641498-20641520 TTTGTTGTTTTGTTGTTTTTGGG - Intronic
1079570956 11:21942778-21942800 TATTATGTTTGGTAGTTGATTGG - Intergenic
1079677950 11:23255616-23255638 TTATATTTTTTGTGTTTTGTGGG - Intergenic
1079754942 11:24245843-24245865 TTCTATGTTTTGTTTTTCATGGG - Intergenic
1079776715 11:24540854-24540876 TTTTTTGTTTTGTGTTATTTAGG - Intronic
1080084435 11:28260961-28260983 ATTTATTTTTTATGGTTTATGGG + Intronic
1080809981 11:35693964-35693986 TTTTAGGTGGTTTGGTTTATGGG - Intronic
1081242666 11:40726155-40726177 TTTTTTTTTTTTTGGTTGATAGG - Intronic
1081466109 11:43319260-43319282 GTTTTTGTTTTTTGGTTTTTGGG + Intronic
1082084185 11:48035553-48035575 TTTTTTTTTTTTTAGTTTATGGG + Intronic
1082142091 11:48620829-48620851 TTTTATGTTTTCCATTTTATTGG + Intergenic
1082569258 11:54717651-54717673 TTTTATGTTTTCCATTTTATTGG + Intergenic
1082618441 11:55391783-55391805 TTTTATGTTTTCCATTTTATTGG + Intergenic
1082622005 11:55434795-55434817 TTTTATGTTTTCAATTTTATTGG + Intergenic
1082624763 11:55469982-55470004 TTTTATGTTTTACATTTTATTGG + Intergenic
1082737096 11:56867614-56867636 TTTTATGTTTTATGTTTAACTGG + Intergenic
1082803045 11:57428105-57428127 TTTTATCTTTTGTGCTTTGGTGG - Intergenic
1083371268 11:62183754-62183776 TTTTATGTTTTCTGTTTGCTTGG + Intergenic
1083868692 11:65473233-65473255 CTTTTTGTTTTTTGGTTTTTTGG - Intergenic
1084103483 11:66965424-66965446 TTTTTTGTTTTTTTGTTTGTTGG + Intergenic
1084136290 11:67184826-67184848 GTTTTTGTTTTGTTTTTTATAGG - Intronic
1084633677 11:70375228-70375250 TTTTTTTTTTTTTGGTCTATTGG + Intronic
1084986673 11:72880094-72880116 TTTTTTGTTTTTTTGTTTTTTGG - Intronic
1085137294 11:74103461-74103483 GTTTAAGTTTTGTGGATTTTTGG + Exonic
1085494389 11:76954560-76954582 TTTTATGTTTTTTTGTTTAGTGG + Intronic
1085800641 11:79586046-79586068 TTTTTTGTTTTTTGGTTTTTTGG - Intergenic
1085800642 11:79586054-79586076 TTTTTTGTTTTTTTGTTTTTTGG - Intergenic
1085820304 11:79785666-79785688 TTTTATAGTTTGTGGCATATAGG - Intergenic
1085826818 11:79856911-79856933 TTCTATGCTTTGTGCTTTAAGGG + Intergenic
1085981125 11:81727433-81727455 TTTTTTGTTTTTTCTTTTATTGG + Intergenic
1086185195 11:84005017-84005039 TTTTTGGTTTTGGGGTTTTTTGG - Intronic
1086270596 11:85060903-85060925 TTTTTTGTTTTGTTTTTTAATGG + Intronic
1086284761 11:85234306-85234328 CTTTATGTTTTGTGGTTATTTGG - Intronic
1086389062 11:86342397-86342419 TTTTATGATTTGTGGATTTGTGG + Intronic
1087054352 11:93919019-93919041 CATTATGTTATGTGCTTTATAGG + Intergenic
1087080312 11:94163992-94164014 TTTTAGGTTTTGCAATTTATTGG + Intronic
1087226886 11:95611081-95611103 TTTTATGTGGTTTGGTTTATGGG - Intergenic
1087320619 11:96653345-96653367 TTTTTTGTTTTCTTGTTTTTTGG - Intergenic
1087395126 11:97587997-97588019 TATTTTATTTTATGGTTTATTGG - Intergenic
1087493202 11:98854573-98854595 TTGTATATTTTGTGGTGTCTAGG - Intergenic
1087568191 11:99890422-99890444 TTTTATATTTTGTGTAATATTGG + Intronic
1087669220 11:101085113-101085135 ATTTACGTTCTGTGGTTGATGGG - Intronic
1087746627 11:101955716-101955738 GATTATTTTTTTTGGTTTATTGG - Intronic
1087924805 11:103907282-103907304 TTTTATGTTTTTTGTCATATCGG - Exonic
1088329185 11:108632634-108632656 TTTTTTTTTTTTTGGTTTTTGGG + Intergenic
1088373654 11:109117923-109117945 GTATATGCTTTGTGGTTTAGGGG + Intergenic
1088721976 11:112600737-112600759 TTTTATGTTTTTTTTTTTTTTGG + Intergenic
1089855418 11:121539714-121539736 CTTTATGTTTTCTGGCTGATTGG - Intronic
1089877426 11:121738365-121738387 TTTTCTGTTTTGTGGAGTATGGG - Intergenic
1089961743 11:122622881-122622903 TTTTTTTTTTTTTGGTTTTTGGG - Intergenic
1090528279 11:127561242-127561264 ATTTATGTTTTGTGGTTCAGGGG + Intergenic
1090653669 11:128826549-128826571 TGTTTTGTTTTCTGGTTTTTTGG - Intergenic
1090898941 11:131008135-131008157 TTTTGTGTTTTCTTTTTTATTGG + Intergenic
1091060456 11:132456565-132456587 ATTTATCATTTGTGGATTATGGG - Intronic
1091094415 11:132806189-132806211 TTTTATCTTTTGTTGTTTTCTGG - Intronic
1091127282 11:133111739-133111761 TGTTTTGTTTTGTTGTTTGTAGG + Intronic
1091920625 12:4301922-4301944 TTTTTTCTTTTTTGGTTTTTTGG + Exonic
1092637895 12:10471126-10471148 TTTTATTGTTTGTGGTTTTTTGG - Intergenic
1093033032 12:14306554-14306576 TTTTATCTTTTGTGCTTTCAAGG + Intergenic
1093297363 12:17406788-17406810 TTTAATGTTTTTGTGTTTATTGG - Intergenic
1093325230 12:17766308-17766330 TTTAATATTTTGCTGTTTATTGG + Intergenic
1093677035 12:21954743-21954765 TTTCTTTTTTTGTGGTTTAGGGG + Intergenic
1093718919 12:22415094-22415116 TTTTAAGTTTTGATGCTTATGGG - Intronic
1093814880 12:23533758-23533780 TTTTGTTTTTTGGGGTTTCTGGG - Exonic
1093883094 12:24428203-24428225 TTTTTTTTTTTTTGGTTTTTGGG - Intergenic
1094130563 12:27070083-27070105 TTGTTTGTTTTGTGCTTAATTGG + Intergenic
1094179964 12:27581760-27581782 TTGTTTGTTTTGTGCTTAATTGG + Intronic
1094210118 12:27880749-27880771 TTTTATTTTTTGTAGTCTTTAGG + Intergenic
1094718762 12:33039939-33039961 TTTTATCTTTTTTGGTATATGGG + Intergenic
1095051564 12:37559213-37559235 TTTTCTGTTTTTAGGTTTAAGGG + Intergenic
1095148250 12:38757496-38757518 TTTTATGTATTATATTTTATTGG + Intronic
1095253329 12:40004021-40004043 TTTTATTTTTTGTGTTTTTTGGG - Intronic
1095371933 12:41478112-41478134 TTTTTTGTTTTTTGTTTTTTTGG + Intronic
1095408631 12:41896458-41896480 TTTGATGTTTTCTGTTTTAAAGG - Intergenic
1095454518 12:42368656-42368678 TTTTATGTTTTGTAGTAGAATGG + Intronic
1095523815 12:43101053-43101075 TTTTTTGTTTTGTGATTAAGTGG + Intergenic
1096107940 12:49009084-49009106 TTGTTTGTTTTGTGGGTTGTTGG + Intronic
1096480356 12:51936266-51936288 TTTTTTTTTTTTTGGTTTAAGGG - Intergenic
1096738838 12:53677075-53677097 TTTTATTTTTTATTTTTTATGGG - Intronic
1097127583 12:56786859-56786881 TTTTTTGTTTGGTTGTTTTTTGG - Intronic
1097254601 12:57664247-57664269 TTTTAGGTGGTTTGGTTTATGGG + Intergenic
1097770252 12:63575675-63575697 TTCTATGTTTTCCGATTTATTGG - Intronic
1097778346 12:63673965-63673987 TTTTTGGTTTTGGGGTTTTTTGG - Intergenic
1098105433 12:67065155-67065177 TTTTATTTTTTGTGGATATTTGG - Intergenic
1098117926 12:67200260-67200282 TTTTTTTTTTTGTAGTTTTTAGG + Intergenic
1098642046 12:72850827-72850849 TTGTAAGTTTTGTGTTTTGTGGG + Intergenic
1099173596 12:79395204-79395226 TTTTTGGTTTTTTGGTTTTTTGG + Intronic
1099389123 12:82057202-82057224 TTATATATTTTTTGTTTTATTGG + Intergenic
1099627719 12:85096622-85096644 ATGTATATTCTGTGGTTTATGGG + Intronic
1099742692 12:86661469-86661491 TTTTATATTTTGTAGTTATTTGG - Intronic
1099815151 12:87636788-87636810 TTATATTTTTTAAGGTTTATAGG - Intergenic
1099887785 12:88552979-88553001 TTATTTGTTGTGTGGTTTATGGG + Intronic
1100028440 12:90157363-90157385 TTTTATGTTTTGAGATATATTGG + Intergenic
1100084179 12:90887429-90887451 TTGTTTGTTTTATAGTTTATAGG + Intergenic
1100424487 12:94471230-94471252 TTTTTTGTTTTTTGGTTTTTTGG + Intergenic
1100630632 12:96385868-96385890 TTTTATGTTTTTTCCTTTAGTGG - Intronic
1101976282 12:109362159-109362181 TTTGGTGACTTGTGGTTTATAGG - Intronic
1101979758 12:109395842-109395864 TTTTTTGTTTTTTTGTTTTTCGG + Intronic
1101979762 12:109395873-109395895 TTTTTTGTTTTGTTTTTTGTTGG + Intronic
1102320404 12:111928638-111928660 TTTGATGTTTTTCAGTTTATGGG - Intergenic
1103254043 12:119524818-119524840 TTTTTTGGTTTTTGGTTTTTGGG + Intronic
1103526150 12:121570018-121570040 TTTTGTGTTTTGGGTTTTTTGGG + Intronic
1103797845 12:123517093-123517115 CTTTATCTTTTGTTGTTTAATGG - Intronic
1103915893 12:124375582-124375604 TTTTATTTTTGGTGGTTTTTTGG - Intronic
1104156106 12:126134371-126134393 TTTTATGTTTTGTGATTACTTGG + Intergenic
1104573837 12:129948845-129948867 CTGTATGTTATTTGGTTTATGGG - Intergenic
1107057128 13:36118465-36118487 TTGTATCTATTGTGGTGTATGGG - Intronic
1107145049 13:37052553-37052575 TTTTATGGTTTATGGTTTTATGG - Intronic
1107199832 13:37701272-37701294 TTTTATTTTTTATTCTTTATTGG + Intronic
1107228409 13:38078625-38078647 TTGTATGTTTTTTGGTTTGACGG - Intergenic
1107235916 13:38170277-38170299 TGTTATATTTTGTGGCATATAGG + Intergenic
1107269367 13:38596360-38596382 TTTTATGTTTTCTCATTTTTAGG - Intergenic
1107279147 13:38713592-38713614 TTTTATCTCCTGTGATTTATCGG + Intronic
1107289155 13:38832644-38832666 TTTTATGTTATATTGTTTGTGGG - Intronic
1107517023 13:41139144-41139166 TCTTATGATTAGTGGTTTGTTGG - Intergenic
1107564287 13:41586151-41586173 TTTTTTTTTTTATGCTTTATGGG - Intronic
1107635700 13:42390240-42390262 TTATATGTTTTGGGGGTTCTTGG + Intergenic
1107641592 13:42449029-42449051 ATTTATATTCTGTGGTTGATGGG - Intergenic
1107747422 13:43525353-43525375 TATAATGATTTGTAGTTTATAGG - Intronic
1108008684 13:45980279-45980301 TTTTATTTTTTGTTTTTTTTGGG - Intronic
1108065643 13:46574834-46574856 TTTTTTTTTTTTTGGTGTATGGG + Intronic
1108305420 13:49127272-49127294 TTTGATGTTTTGTTGTTTTCAGG - Intronic
1108393121 13:49967711-49967733 TTTTTTGGTTTTTGGTTTCTTGG + Intergenic
1108758249 13:53530236-53530258 TTTTATGTCATCTGTTTTATTGG + Intergenic
1109078607 13:57868853-57868875 TTGTATATTCTGTGGTTGATGGG - Intergenic
1109299699 13:60578314-60578336 TTAAATGCTTTGAGGTTTATAGG + Intergenic
1109476362 13:62884893-62884915 TTTTATCTTTGGTGATTTTTTGG - Intergenic
1109494758 13:63154906-63154928 GTTTATGTTCTGTAGTTTAGAGG - Intergenic
1109563759 13:64083421-64083443 TTTTTTGTTTTTTGGTTGGTAGG - Intergenic
1109580403 13:64324127-64324149 TTTTTTGTTGTTTTGTTTATTGG + Intergenic
1109996894 13:70139981-70140003 TTTTTTATTTTTTGGTGTATGGG - Intergenic
1110074535 13:71222917-71222939 TTTTTTTTTTTTTGGTTTAATGG - Intergenic
1110442398 13:75539774-75539796 TTGTTTGTTTTTTGGTTTTTTGG - Intronic
1110707845 13:78615317-78615339 TTTTGTGTTTTGGGGTTGGTTGG - Exonic
1110756039 13:79175354-79175376 TTTTTTGTTTTGTCCTTTATGGG - Intergenic
1110937246 13:81306462-81306484 TTTGATTCTTTGTGATTTATTGG - Intergenic
1111134651 13:84025292-84025314 TTGTTTGTTTTGTGGGTTTTGGG - Intergenic
1111172337 13:84543666-84543688 TTTGCTTTTTTGTAGTTTATAGG + Intergenic
1111403735 13:87774554-87774576 TTTTATGTTTTGAGTCTTGTGGG - Intergenic
1111621067 13:90726654-90726676 TTTTATTTTTAGTAGCTTATTGG + Intergenic
1112053344 13:95666642-95666664 TTTTAGGTTTTCTAATTTATTGG + Intergenic
1112158795 13:96847459-96847481 TTTTTTGTTTTTTGTTTTTTTGG - Intergenic
1113098292 13:106689595-106689617 TTCTTTCTTTTCTGGTTTATTGG - Intergenic
1113143806 13:107184823-107184845 TTTAATTTTCTGTGTTTTATAGG + Intronic
1113293468 13:108931606-108931628 TCTTATAATTTGTGCTTTATTGG - Intronic
1113394145 13:109929459-109929481 TTTTTTGTTTTGTTGTGTTTTGG - Intergenic
1113404581 13:110026535-110026557 TTTTATTTTTTGTTTTTTATTGG - Intergenic
1113729662 13:112631758-112631780 TTTTATGTTTTGTGCATCTTTGG - Intergenic
1113840060 13:113354094-113354116 GTCTCTGTTTTGTGGTTTTTTGG - Intronic
1114058756 14:19000096-19000118 TTTTTTGTTTTGTTTTTTATTGG + Intergenic
1114103788 14:19401658-19401680 TTTTTTGTTTTGTTTTTTATTGG - Intergenic
1114253438 14:20981273-20981295 TTTTTGGTTTTTTGGTTTTTTGG + Intergenic
1114335144 14:21681496-21681518 TTTTAGGTGGTTTGGTTTATGGG + Intergenic
1114449901 14:22818586-22818608 TTTTTTTTTTTTTGGTTTTTGGG + Intronic
1114543270 14:23479662-23479684 TATTAAGATTTGTGGATTATGGG + Intronic
1114942708 14:27634831-27634853 TTTTATGTTTGTGAGTTTATTGG + Intergenic
1114955178 14:27808406-27808428 TTTTTTGTTTTTTGTTTTTTTGG - Intergenic
1115044987 14:28981085-28981107 TTTTTTTTTTTTTGGTTGATAGG - Intergenic
1115311348 14:31981726-31981748 ATGTATGTTTTGTGGTTGTTGGG + Intergenic
1115400939 14:32959264-32959286 TTAAAGGTTTTGTGGTTTCTGGG - Intronic
1115478993 14:33843538-33843560 TTTTCTGTTTGGTTGTTTTTTGG - Intergenic
1115483135 14:33882123-33882145 TTTTATGTTCTGTAATTAATAGG - Intergenic
1115834596 14:37385953-37385975 TTTTATATCTTTTGCTTTATAGG + Intronic
1116005818 14:39288930-39288952 ATTTATTTTTTGTGGTTTCTTGG + Intronic
1116028710 14:39544814-39544836 TTTTTTGTTTTTTGTTTTTTTGG + Intergenic
1116146589 14:41079805-41079827 TTTTATTTTTTGGAATTTATAGG - Intergenic
1116195004 14:41714366-41714388 TATTATGTTTTGTGCTTTGGGGG - Intronic
1116222566 14:42107587-42107609 GTTTTTGTTTTTTGGTTTGTAGG + Intergenic
1116483943 14:45424375-45424397 TTTTAGGTGGTTTGGTTTATGGG + Intergenic
1116880825 14:50167055-50167077 TTGTTTGTTTTGGGGTTTTTAGG - Intronic
1117167846 14:53057594-53057616 TTTTAAGATTTATGGTTTCTAGG + Intronic
1117175314 14:53139832-53139854 TTTTTTTTTTTGTGGTCTCTTGG - Intronic
1117187014 14:53250110-53250132 GTTTTTGTTTTTTGGTTTTTTGG - Intergenic
1117521512 14:56556204-56556226 TTTTTTGTTTTGTTTTTTCTAGG - Intronic
1117694026 14:58340338-58340360 TTTTTGGTTTTTTGGTTTTTTGG + Intronic
1117843384 14:59884584-59884606 TTTTCTCTTTTGTTGCTTATAGG + Intergenic
1117863251 14:60115581-60115603 TGTTATGGTTTTTTGTTTATTGG + Intronic
1117909116 14:60619561-60619583 TTTTTTGTTTTTTGGTTTTTTGG + Intergenic
1118067225 14:62205439-62205461 GTTTATGTTTTGTGTTTTTTTGG + Intergenic
1118288537 14:64500445-64500467 TTTTTTTTTTTTTGCTTTATTGG - Intronic
1118613406 14:67558810-67558832 TTTTATGTTTTGTGGGCCACAGG + Intronic
1118692596 14:68354194-68354216 TTTTTTGGTTTTTGGTTTTTTGG + Intronic
1118891577 14:69914252-69914274 TTTTAGGCTTTGTGGGGTATAGG + Intronic
1119155084 14:72402768-72402790 TTTTATATTTTTTGTTTTTTTGG + Intronic
1119215727 14:72867738-72867760 TTTTTTGTTTTTTGTTTTATTGG + Intronic
1119318052 14:73712454-73712476 TGTTCTGTTTTGTTGTTTTTTGG - Exonic
1119494640 14:75068328-75068350 TTTTCTGTTTTGTTGGTTTTTGG - Intronic
1120346406 14:83296304-83296326 TTTTCTGTTTTCTGGTAGATAGG - Intergenic
1120404252 14:84074178-84074200 TTTTTTGTTTTGTTTTTTTTTGG + Intergenic
1120447257 14:84615389-84615411 TTTCATTTCTTGTGGTTTATGGG - Intergenic
1120816592 14:88866249-88866271 TCTTTTGTTTTGTTGTATATGGG - Intronic
1121402248 14:93690064-93690086 TTTTATGTTTTGTGTTTCATTGG - Intronic
1121497008 14:94399575-94399597 TTTTTTGGTTTTTGGTTTTTTGG - Intergenic
1121836203 14:97094616-97094638 TTATATGTTTTGTGCTTCATTGG + Intergenic
1122176722 14:99926261-99926283 TCTTATTTTTTGTGTTTTTTGGG + Intronic
1122398599 14:101452940-101452962 TTTTCTTTTTTGTTGTTTTTGGG + Intergenic
1122696482 14:103555580-103555602 TTTTTTGTTTTTTGTTTTTTTGG - Intergenic
1123103653 14:105824698-105824720 TTTTATATTTTTTGGATTTTGGG + Intergenic
1123407598 15:20030550-20030572 TTTTCTTTTTTGTTGTTTTTTGG - Intergenic
1123516926 15:21037206-21037228 TTTTCTTTTTTGTTGTTTTTTGG - Intergenic
1123573691 15:21643458-21643480 TTTAATTTTTTGAGGTTCATTGG - Intergenic
1123835134 15:24182071-24182093 TTTGATGTTGTGTGGTTGGTTGG + Intergenic
1123854829 15:24397982-24398004 TTTAATGTTGTGTGGTTGGTTGG + Intergenic
1123870858 15:24570966-24570988 TTTGATGTTGTGTGGTTGGTTGG + Intergenic
1124039649 15:26089017-26089039 TTTTAGGTGATTTGGTTTATGGG - Intergenic
1124808071 15:32906490-32906512 TTTTAGGCTTTGTGGCTTACGGG - Intronic
1124916787 15:33983267-33983289 TTTTATCTTTTGTCATTTGTTGG - Intronic
1124961714 15:34402070-34402092 TTTTTTGTTTTGTGATTCTTCGG - Intronic
1124978340 15:34548292-34548314 TTTTTTGTTTTGTGATTCTTCGG - Intronic
1125046757 15:35250185-35250207 TTTTTTGTTTTTTGTTTTTTTGG - Intronic
1125051797 15:35307644-35307666 TTTTAGGTATTGTAGTATATAGG + Intronic
1125063252 15:35450319-35450341 TGTTTTGTTTTGAGGTTTTTTGG - Intronic
1125172339 15:36779782-36779804 TTTTTTGTTTTGTTTTTTAGAGG + Intronic
1125439487 15:39686865-39686887 TTTTATGTTTTGTTTGTTGTTGG + Intronic
1125465140 15:39943557-39943579 TAGCATGTTTTGTGTTTTATTGG + Intronic
1125570676 15:40715371-40715393 TTTTTTGTTTTGTGGTTTTTTGG - Intronic
1125703580 15:41710669-41710691 TTTTATGTTTTCTTATTTCTAGG + Exonic
1125934079 15:43619602-43619624 ATTTTTGTTTTTTGTTTTATTGG + Intergenic
1125991065 15:44108656-44108678 TTTTTTGTTTTTTTGTTTTTTGG - Intronic
1126195805 15:45929458-45929480 TTTTATGGATTGTGCTTTTTTGG + Intergenic
1126525161 15:49645876-49645898 TTTTTTGTTTTTTGTTTTTTTGG + Exonic
1126628913 15:50713822-50713844 TTTTTTGTTTTGTTGTTTGTTGG - Intronic
1127163974 15:56223878-56223900 TTTTATCTTTTGTGATTACTGGG - Intronic
1127167322 15:56259067-56259089 TTTTATGTTTTATGTTTTTGGGG + Intronic
1127168593 15:56274797-56274819 TTTTATGTTTTGCTGTTGCTGGG + Intronic
1127369029 15:58319192-58319214 TTTTATGTCTTCTGGTGGATAGG - Intronic
1128556072 15:68632587-68632609 TTTTAATTTTTGTGTTTTTTTGG + Intronic
1128673134 15:69589251-69589273 TTTTATTTTTTGTGTATGATAGG - Intergenic
1128857189 15:71028706-71028728 TTCTAAGTTTTCTAGTTTATTGG + Intronic
1129366417 15:75058306-75058328 CTTCATGTATTGTGGTTTCTAGG + Intronic
1129569347 15:76662920-76662942 TTTTATGTCTAGTGCTTTCTGGG - Intronic
1129611089 15:77058027-77058049 GTTGAAGTTTTGTGATTTATGGG - Intronic
1129649864 15:77476850-77476872 TTTTATTTTTAATGGCTTATTGG + Intronic
1129908992 15:79210315-79210337 TTTTGTCTTTTTCGGTTTATAGG + Intergenic
1130024270 15:80257965-80257987 TTTTTTGTTTTTTTGTTTTTTGG + Intergenic
1130248360 15:82275272-82275294 TTTTTTTTTTTTTGGTTGATAGG - Intronic
1130265526 15:82398641-82398663 TTTTTTTTTTTTTGGTTTAGAGG + Intergenic
1130461172 15:84159135-84159157 TTTTTTGTTTTTTGTTTTTTTGG - Intergenic
1130646856 15:85736068-85736090 ATGTATGTTTTTTGTTTTATAGG + Exonic
1130811128 15:87379521-87379543 TTTTTTGTTTTGTGTTTGTTTGG - Intergenic
1131183343 15:90255359-90255381 TTTTATCTTTTGTGTCTTTTGGG + Intronic
1131263257 15:90900817-90900839 TTTTATTTTTTGTGGTGGGTGGG - Intergenic
1131329410 15:91482867-91482889 TGTTATGTTTTTTTGTATATAGG + Intergenic
1131506066 15:93020420-93020442 TGTTTTGTTTTGTGGGTCATAGG + Intronic
1131594939 15:93788065-93788087 TTTTCTGGTTGGTGGTTTACAGG + Intergenic
1131739137 15:95368184-95368206 ATTTATGTGTTGTGGTGTGTTGG + Intergenic
1131854368 15:96577720-96577742 TTTTATGTTTTCTACATTATAGG + Intergenic
1132278393 15:100590807-100590829 TTTTAGGTGGTTTGGTTTATGGG + Intronic
1132380889 15:101366083-101366105 TTCTTTGTTTTGTGTTTTAGAGG - Intronic
1133308614 16:4827912-4827934 TTTTTGGTTTTTTGGTTTTTTGG - Intronic
1133531462 16:6658906-6658928 TTTTTTGTTTTTTTGTTTTTTGG + Intronic
1133670855 16:8018675-8018697 TTTTTTTTTTTTTGGTGTATAGG - Intergenic
1133794167 16:9032977-9032999 TTTTTTGTTTTTTGTTTTTTTGG - Intergenic
1133813408 16:9178369-9178391 TTTTTTGTGTTTTGGTTTTTTGG - Intergenic
1133882669 16:9797766-9797788 TTTTGTGTTTTGTGATGTAGGGG + Intronic
1133910150 16:10058278-10058300 TTTTTTGTTTTTTTGTTTTTTGG - Intronic
1134198963 16:12181811-12181833 GCTTATATTTTGGGGTTTATGGG + Intronic
1134344341 16:13375672-13375694 TTTTTTGTTTTTTTGTTTTTTGG - Intergenic
1134378798 16:13704628-13704650 TTTTCTGTTTTTTGTTTTTTGGG + Intergenic
1135178954 16:20256331-20256353 TTTTAGGTTTTGTGGGCCATAGG + Intergenic
1135357616 16:21782678-21782700 TTTTATTCTTTTTGGTTTATTGG + Intergenic
1135385548 16:22036434-22036456 TTATTTGTTTTTTGGTTTTTAGG + Intronic
1135404362 16:22187593-22187615 TTTTTTTTTTTTTGGTTTTTAGG - Intronic
1135421998 16:22311449-22311471 TTTTATGTTTAGGGTTTTTTGGG + Intronic
1135456120 16:22598794-22598816 TTTTATTCTTTTTGGTTTATTGG + Intergenic
1135488094 16:22883589-22883611 TTTTGTTTTTTGTGGTTTTTTGG + Intronic
1135696879 16:24595987-24596009 ATTTAAGTTTTGGGGTTTTTTGG + Intergenic
1135774109 16:25241227-25241249 TTTCATTTAGTGTGGTTTATGGG - Intronic
1136018131 16:27419208-27419230 TTTTTTGTTTTTTGTTTTCTGGG - Intronic
1136371987 16:29842284-29842306 TTTTTAGTTTTTTGGTTTTTTGG + Intronic
1136371988 16:29842292-29842314 TTTTTGGTTTTTTGGTTTTTTGG + Intronic
1136748242 16:32611259-32611281 TTTTTTTTTTTGTGGTATTTGGG + Intergenic
1137258889 16:46805391-46805413 ATCTATGTTTTGGGGTTTTTTGG + Intronic
1137350242 16:47707372-47707394 TCTTATGTTTTGTGTCTTCTTGG - Intergenic
1138364529 16:56463402-56463424 TTTTTTTTTTTTTGGTTTGTTGG + Intronic
1138721040 16:59079202-59079224 TTTTTTGTTTTTTTGTTTTTTGG - Intergenic
1138994267 16:62429506-62429528 TTTAATGTTTTATGCTTTTTTGG - Intergenic
1139148747 16:64354176-64354198 CTATATGTATTGTGATTTATAGG + Intergenic
1139158589 16:64475428-64475450 TTTTTTTTTTTTTGGTTTCTTGG - Intergenic
1139568123 16:67792610-67792632 TTTTGTATTTTGTATTTTATGGG - Intronic
1139860633 16:70017906-70017928 TTTTTTGTTTTGTTTTTTACTGG + Intergenic
1140261871 16:73387511-73387533 TTTTTTGTTTTTTGTTTTAAAGG + Intergenic
1140277813 16:73526492-73526514 GTTTATGTTTTGTATTTTATAGG - Intergenic
1140592361 16:76369025-76369047 TTTTTTGTTTTTTCGTTTTTTGG + Intronic
1140751119 16:78024810-78024832 TTTTGTGTTTTGTTTTTTGTAGG + Intronic
1140820413 16:78657838-78657860 TTTTTTGTTTTTTTGTTTTTCGG + Intronic
1141562969 16:84882338-84882360 TTTTTTTTTTTTTGCTTTATTGG - Intronic
1143420376 17:6786627-6786649 TTTTAATTTTTGTGGTACATAGG - Intronic
1144422098 17:15108136-15108158 TTTTTTGTTTTTTGTTTTTTGGG + Intergenic
1145083511 17:19915866-19915888 TTTTATGTTTAGTGTTTTTAAGG - Intronic
1145950048 17:28809800-28809822 TTTTATGTTTTGTAGAGAATAGG - Intronic
1146187988 17:30737991-30738013 TTTTTTGTTTTTTGTTTTTTTGG + Intergenic
1146402303 17:32509486-32509508 TTTTATGTCCTGAGGTTTAATGG + Intronic
1146444763 17:32924747-32924769 TTTTAGGTGGTTTGGTTTATGGG + Intergenic
1147711806 17:42472422-42472444 TTTTATTTTTTATTGTTTTTAGG + Intronic
1147938822 17:44030684-44030706 ATTTATCTTTAGTGGTCTATTGG - Intergenic
1148001827 17:44392742-44392764 TTTTTTGGTTTTTGGTTTTTTGG - Intergenic
1148061604 17:44840573-44840595 TTTTAGGTTTTGGGGTTTTTTGG - Intergenic
1148338507 17:46858379-46858401 TTGTATGGTTTGTGCTTTGTTGG + Intronic
1148609738 17:48956786-48956808 TTTTTTCTTTTCTGGTTAATTGG + Intergenic
1149024794 17:52015132-52015154 TTTTGTGTTCTGTGTTTTCTTGG - Intronic
1149677822 17:58482291-58482313 TTTTATTTTTTGTACTTTAAAGG - Intronic
1149937580 17:60824271-60824293 TTTTCTGTTTTGTGGGATTTCGG + Intronic
1150171257 17:62997830-62997852 TTTTTGGTTTTGTGGTGGATTGG - Intergenic
1150192011 17:63252793-63252815 TTTTTTGTTTTGTTGTGTTTTGG + Intronic
1150671784 17:67206898-67206920 TTTTTTGTTTTTTGTTTTTTTGG + Intronic
1150811286 17:68359197-68359219 TTTTTTGTTTTTTGGGTTTTGGG - Intronic
1150990087 17:70247370-70247392 TTTTTTGGCTTGTGGTTTCTAGG - Intergenic
1151260056 17:72909100-72909122 CTTTTTGTTTTGTTGTTTTTTGG + Intronic
1151484125 17:74387914-74387936 TATAATATTTTGTGGTTGATGGG - Intergenic
1151773755 17:76183454-76183476 TTTTTTGTTTTGTTTTTTAGAGG + Intronic
1152051337 17:77980968-77980990 TGTTATGTTTTTTGGTTTTTTGG + Intergenic
1152872376 17:82763356-82763378 TTTTATGATTTGTGATTGGTTGG + Intronic
1152883905 17:82836714-82836736 TTTTTTGTTTTTTTGTTTTTTGG - Intronic
1153337496 18:3939481-3939503 TTGTTTGTTTTTTGGTTTTTGGG - Intronic
1153515737 18:5899293-5899315 TTTCATGTTTTCTGTCTTATCGG - Intergenic
1153570378 18:6466255-6466277 TTTTGTGTTTTGTGTTTTTTTGG + Intergenic
1153802149 18:8680923-8680945 TTTTTTGTTTTTTTGTTTTTTGG - Intergenic
1153960918 18:10139486-10139508 TTTTTTTTTTTTTGGTTTTTGGG + Intergenic
1154251615 18:12749685-12749707 TTTTTTGTTTTTTGGTTTTTGGG + Intergenic
1154950696 18:21206643-21206665 TTTTATGATTTGTCGGTTTTAGG + Intergenic
1155527611 18:26733089-26733111 TTTTATTTTTTAAGTTTTATGGG + Intergenic
1155742156 18:29301696-29301718 TTTTATGTTCTGGGGTACATGGG - Intergenic
1155833741 18:30551531-30551553 TTTTCTGTTTTGTGAAGTATGGG + Intergenic
1155913700 18:31534861-31534883 TCTTATGTTCTGTTGTTTATTGG - Intronic
1156056986 18:33018260-33018282 TTTTTTGTTGTTTGGTTGATTGG - Intronic
1156095736 18:33529790-33529812 GTTTATCTTTTTTGTTTTATTGG + Intergenic
1156424279 18:36992279-36992301 TTTTATGGTTTGTGCTTTTTGGG + Intronic
1156441754 18:37197045-37197067 TTCTAGGTTTTCTAGTTTATTGG + Intronic
1156531270 18:37818702-37818724 TTTTATGCTTTATGTTTTATGGG - Intergenic
1156535076 18:37854854-37854876 TTTTATTTTTTGTTTTTTGTGGG + Intergenic
1156604099 18:38645104-38645126 TGTGCTGTTTTGTGGTTAATAGG + Intergenic
1156741376 18:40333221-40333243 TTATATGTTTTCTGTTTTTTGGG + Intergenic
1156912132 18:42423767-42423789 TTTTCTGGTTTGTGGTGTAAAGG + Intergenic
1156936793 18:42719111-42719133 TTTAATGGTTTGTTATTTATTGG + Intergenic
1157239313 18:45995058-45995080 TGTTTTGTTTTGTTTTTTATGGG + Intronic
1157631223 18:49098307-49098329 TTTTATGTCTTCTATTTTATAGG + Intronic
1157978474 18:52353146-52353168 TCTTCTGGTTTGTGGTTTAGCGG + Intronic
1158209261 18:55028211-55028233 TTCTTTGTTTTGTGGTTTGTTGG - Intergenic
1158386254 18:56995655-56995677 TGTAATGTTTTGTGGTATAAAGG - Intronic
1158628170 18:59089629-59089651 TTTTTTGTTTTTTGTTTTTTGGG - Intergenic
1158644395 18:59231861-59231883 TTGTTTGTTTTTTGGTTTTTTGG - Intergenic
1158675800 18:59517034-59517056 TTCTATATTGTGTGGTTTAAGGG - Intronic
1158685198 18:59607530-59607552 TTTTGTGTAGTGTGATTTATGGG - Intronic
1158981258 18:62764193-62764215 TTGTTTGTTTTGTGTTTTTTTGG - Intronic
1159137154 18:64349814-64349836 TGTTTTGCTTTGTGTTTTATAGG - Intergenic
1159351672 18:67283310-67283332 TTTTACATATTGTGTTTTATAGG - Intergenic
1159365502 18:67461515-67461537 ATGTATATTTTGTGGTTGATGGG + Intergenic
1159562063 18:70006627-70006649 TTTTATGCCATGTGGTATATGGG + Intronic
1159963506 18:74574426-74574448 TTTTCTGTTTTATGGCTTTTAGG - Intronic
1160320615 18:77890428-77890450 TTTTTTGTTTTTTTTTTTATGGG + Intergenic
1164023347 19:21328715-21328737 TTTTGTAGTTTGTGGTTCATGGG - Intronic
1164037503 19:21467375-21467397 TTTTGTGTTTGTTTGTTTATGGG + Intronic
1164064495 19:21703928-21703950 TTTTAGCTTGTGTGGTTTTTGGG - Intergenic
1164279950 19:23760279-23760301 TTTTGTGTTTTCTTATTTATGGG + Intergenic
1164934075 19:32197591-32197613 TTTTTGGTTTTTTGGTTTTTTGG + Intergenic
1165186233 19:34024550-34024572 ATTTTTGTTTTGAGGTTTCTGGG + Intergenic
1165552946 19:36604486-36604508 TTTTAAGTTACGTGGTTTCTTGG - Intronic
1165853461 19:38865340-38865362 TTTTATTTTTTGTTGTTTGTCGG - Intergenic
1166616207 19:44249572-44249594 TTTTATTTTTTGTTGTCAATGGG + Intronic
1166925813 19:46266612-46266634 TTTTTTGTTTTTTGTTTTTTGGG + Intergenic
1168004912 19:53478934-53478956 TTTTGTTTTTTGTGTTTTTTTGG + Intronic
925442005 2:3896076-3896098 TTTTTTTTTTTTTGGTTGATAGG + Intergenic
925584950 2:5456243-5456265 TTTTAGGCCTTTTGGTTTATTGG - Intergenic
925625835 2:5841598-5841620 GTTTTTGTTTTTTGGTTTTTTGG + Intergenic
925696708 2:6587769-6587791 TTTTATGTTTTATGGATTTGTGG + Intergenic
925724174 2:6857308-6857330 TTTTTTGTTTTATTGTTTTTGGG + Intronic
925824204 2:7831243-7831265 TTTTATTTTTTGTTGTTACTTGG + Intergenic
925950488 2:8905336-8905358 TTTTTTGTTTTGTTTTTTAATGG - Intronic
926359406 2:12071484-12071506 TTTTTTTTTTTTTGGTTTAGAGG - Intergenic
926654259 2:15383151-15383173 TTTTAATTGTTATGGTTTATTGG - Intronic
927368728 2:22329816-22329838 TTTTTTTTTTTTTGGTTTATGGG - Intergenic
927399301 2:22692501-22692523 TTTTTTGTTTTCTGTTTTTTTGG - Intergenic
927568124 2:24132478-24132500 TTTTTTTTTTTTTGGTTGATAGG + Intronic
927590478 2:24352669-24352691 TTTTATGTCTCCTGGCTTATTGG - Intronic
928068370 2:28189593-28189615 TTTTATACTTTTTGGTATATGGG - Intronic
928362245 2:30674528-30674550 TTTTATGTTTTCTTGTTTTCAGG - Intergenic
928382662 2:30833283-30833305 TTTTATATGGTTTGGTTTATGGG + Intergenic
928635231 2:33238916-33238938 TTTTATGTTGGGTTGTTCATAGG + Intronic
928670792 2:33601308-33601330 TTTTATATATTATGGTTTAAAGG + Intergenic
929037065 2:37703972-37703994 TTCTAGGTTTTCTAGTTTATGGG + Intronic
929206021 2:39294223-39294245 TTTTATGTTTTGTAATTTTAAGG - Intronic
929265311 2:39912553-39912575 TTTTCTGTTTTTTGTTTTTTTGG + Intergenic
929347986 2:40910096-40910118 TTTTTTGTTTTTTGTTTTAAAGG + Intergenic
929448552 2:42020436-42020458 TTTTTTTTTTTGTGGGTTGTGGG - Intergenic
929625237 2:43399871-43399893 TTTTTTGTTTTTTTGTTTTTTGG - Intronic
929646490 2:43633574-43633596 TTTTATGTGTGGTGGATTAAAGG + Intergenic
929650227 2:43672258-43672280 TTTTTTCTTTTTTGCTTTATTGG + Intronic
930371337 2:50505211-50505233 TTTTGTGTGTTTTGGTTTGTTGG - Intronic
930498537 2:52180184-52180206 TTTTAGGTGGTTTGGTTTATGGG + Intergenic
930548685 2:52803280-52803302 TTGGATGTTTTGTGGTTTGAGGG - Intergenic
930757950 2:54997513-54997535 TTTTGTGTTTTCTAGTTTCTTGG - Intronic
930927108 2:56831706-56831728 TTTTATCTTTTGTTGGTTTTTGG - Intergenic
931003125 2:57812926-57812948 GTTTTCTTTTTGTGGTTTATTGG - Intergenic
931136144 2:59403398-59403420 TTTTTTGTTTTTTTTTTTATAGG - Intergenic
931213186 2:60216624-60216646 CTTTATCTGTTGTGGTTTGTGGG - Intergenic
931249219 2:60515406-60515428 TTTTATTTTTTGTGCCTTCTTGG - Intronic
931259939 2:60608673-60608695 TATTATATTTTGGGGTTTTTTGG + Intergenic
931553952 2:63479067-63479089 TTCTAGGTTTTCTAGTTTATGGG - Intronic
931606338 2:64056685-64056707 TTTCATGTCTTGTGCTTTTTGGG + Intergenic
931773235 2:65517522-65517544 TTTTTTTTTTTTTGGTTTTTTGG - Intergenic
932363733 2:71131855-71131877 TTATTTCTTTTGTGGTTTTTCGG + Intronic
932390069 2:71380878-71380900 TCTTATGTTTTGTGTCTTGTGGG - Intronic
932470957 2:71956797-71956819 TTTTTTTTTTTTTGGTTTCTAGG - Intergenic
932640627 2:73441784-73441806 TTTTTTGTCTTTTGGTTTCTAGG + Intronic
932800917 2:74741653-74741675 TGTTTTGTCTTGTGGTTTTTAGG - Intergenic
932943813 2:76203218-76203240 TTTTTTGTTTTTTGTTTTTTTGG + Intergenic
933077711 2:77950571-77950593 TTTTAGGTGGTTTGGTTTATGGG - Intergenic
933116732 2:78483045-78483067 TTTTAAGTTTTATGTTATATAGG + Intergenic
933207189 2:79520464-79520486 TTTTATGATTAGTGCTTTTTGGG - Intronic
933461867 2:82598548-82598570 TTTTTTGTTTGTTTGTTTATGGG + Intergenic
933667778 2:84978479-84978501 TTTTTTGTCTTTTGGTTTTTGGG + Intronic
933751639 2:85606072-85606094 TTTAAGGTTTTGTGGTTCCTCGG - Intronic
933829693 2:86196890-86196912 TTCTATGTTCTATGGTTTTTAGG + Intergenic
934015488 2:87876675-87876697 TATTATATTTTGTTGTTTTTGGG + Intergenic
934859650 2:97753804-97753826 TTTTATTTTTTGTTTTTTATAGG - Intergenic
934948394 2:98558875-98558897 TGTTAAGTTTTGTGATTTAGGGG - Intronic
935379600 2:102438112-102438134 CTATATGTTTTTTGGTTCATTGG + Intronic
935566288 2:104611105-104611127 TTTTTTGTTTTGTCTTTTTTTGG - Intergenic
935936282 2:108187044-108187066 TTTTATTTTTAGTGTTTTATCGG - Intergenic
936238833 2:110769863-110769885 TTTAGTGTTTTGGGGTTTTTGGG - Intronic
936369380 2:111890945-111890967 GTCTAGGTTTTGTAGTTTATTGG - Intergenic
936750042 2:115631051-115631073 TTTTTTTTTTTGTGGTTTGTAGG + Intronic
936815239 2:116452552-116452574 TTTTTTGTTATGTTGTTTGTTGG + Intergenic
937022131 2:118667244-118667266 TCTTATGATTTCAGGTTTATGGG - Intergenic
937101651 2:119275827-119275849 ATTTATGTTTTAGGGTTTGTAGG - Intergenic
937144641 2:119633325-119633347 ATTTATGGATTGTGGTTTTTTGG - Intronic
937282241 2:120726958-120726980 TTTTATTTTTTGTAGTATAAAGG - Intergenic
937370997 2:121297048-121297070 TTTTCTGTTTTTTGTTTTTTTGG + Intergenic
937566660 2:123299625-123299647 ATTTATTTTGTGTGGTGTATAGG + Intergenic
937733374 2:125260966-125260988 CTTTATGTTTTGAGATGTATGGG + Intergenic
937737551 2:125310789-125310811 TCTTAGGTTATGTGGTTTGTTGG - Intergenic
937778829 2:125812943-125812965 TTTTGGGTTTTGGAGTTTATAGG + Intergenic
937820920 2:126308948-126308970 TTTTTTGTTTTGGGTTTTCTTGG + Intergenic
938178225 2:129155853-129155875 TTTCATGTTGTCTGGTTTTTAGG + Intergenic
938195940 2:129328087-129328109 TTTTTTGTTTGGTGTTATATAGG - Intergenic
938282440 2:130074121-130074143 TTTTTTGTTTTGTTTTTTATTGG - Exonic
938333069 2:130462693-130462715 TTTTTTGTTTTGTTTTTTATTGG - Exonic
938356742 2:130657978-130658000 TTTTTTGTTTTGTTTTTTATTGG + Exonic
938433178 2:131264784-131264806 TTTTTTGTTTTGTTTTTTATTGG + Exonic
938477224 2:131627367-131627389 TTTTTTGTTTTGTTTTTTATTGG + Intergenic
938542033 2:132291181-132291203 TTTTAAGTTCTGGGGTATATGGG + Intergenic
938747835 2:134297025-134297047 TTTTATTTTTTGTAGATAATGGG - Intronic
938913595 2:135910636-135910658 TTGTTTGTTTTGGGGTTTTTTGG - Intronic
938925533 2:136037808-136037830 TTTTATTTTTTGTGAGTTATTGG + Intergenic
938984683 2:136562770-136562792 TTTTATGCTTGTTGGGTTATAGG + Intergenic
939134533 2:138277879-138277901 TGTTATTTGTTGTGGTTCATTGG + Intergenic
939269100 2:139914255-139914277 TGTTATGTTTTATGTTTTTTGGG - Intergenic
939822365 2:146972664-146972686 TTTTATTTATTGTGATTTGTAGG - Intergenic
939989325 2:148862513-148862535 TTTTATGTATTGTGTTTTAATGG + Intergenic
940321601 2:152383284-152383306 TTTTTTTTTTTGTAGTTTAGGGG + Intronic
940470695 2:154095895-154095917 CTATGTATTTTGTGGTTTATAGG - Intronic
940605076 2:155912419-155912441 TTTTTTGCTTTGTGATTTAGGGG - Intergenic
940619548 2:156093894-156093916 TTGTTTGTTTTGTTTTTTATAGG - Intergenic
940719620 2:157267865-157267887 TTTCATGTTTTGTTCTTTCTAGG - Intronic
940725152 2:157328593-157328615 TTTTATTTTATGTAGTTTACTGG + Intergenic
940731119 2:157393619-157393641 TTTTTTGTTTTTTTGTTTCTAGG + Intergenic
941018557 2:160384467-160384489 TTGTTTGTTTTGAGGTTTAGAGG - Intronic
941188878 2:162351589-162351611 TTTTTTGTTTTGTTGTTTCTTGG + Intronic
941192673 2:162405371-162405393 TATTATGTTTTGTTGTTGTTGGG - Intronic
941731165 2:168919854-168919876 TGTTTTGTTTTTTGGTTTTTTGG + Intergenic
941743849 2:169065396-169065418 TTTTTTGTTTTGGGGTTTTTTGG + Intronic
941905457 2:170714208-170714230 TCGTATGATTTGTGGTTTGTGGG + Exonic
942587526 2:177499603-177499625 TTTTTTTTTTTGTAGTTTAAAGG + Exonic
943055093 2:182967361-182967383 TTTTTTTTTTTGTACTTTATAGG - Exonic
943124992 2:183785002-183785024 TTATATGATTTGTGGATAATTGG + Intergenic
943167930 2:184355448-184355470 TTATAAATTTTGTAGTTTATGGG - Intergenic
943194874 2:184733218-184733240 TTTTAGGTTCTGTTATTTATGGG + Intronic
943389490 2:187245915-187245937 TTTTATGTTTTATACTTTTTGGG - Intergenic
943514349 2:188865760-188865782 TTTTTTTTTTTTTGGTTTTTGGG - Intergenic
943579277 2:189665459-189665481 TTTTCTTTTTTGGGGTTTTTGGG + Intronic
943797695 2:192017620-192017642 TTTTATCTTTCATGCTTTATAGG + Intronic
943869222 2:192972616-192972638 TTTTTTGTTTTGTGTTGTTTTGG + Intergenic
943884301 2:193194655-193194677 TTATAGGTTTTCTGTTTTATTGG + Intergenic
943969115 2:194380515-194380537 TTTTAGGTGGTTTGGTTTATGGG - Intergenic
944020331 2:195094956-195094978 TGCTATGTTTTGTTTTTTATTGG - Intergenic
944045756 2:195410027-195410049 GTTTATGTTTTGTACCTTATCGG + Intergenic
944162890 2:196685195-196685217 TATTCTGTATTTTGGTTTATAGG + Intronic
944249590 2:197567762-197567784 TTTTGTTTTTTGTGGGTTTTTGG - Intergenic
944466364 2:200003973-200003995 TTTAATGTTTTCAGGTTGATAGG + Intronic
944467643 2:200018993-200019015 TTTTCTGGTCTGTGGTTTTTAGG + Intergenic
944521073 2:200567370-200567392 TTTTATGTTTTATATTTCATTGG + Intronic
944575790 2:201090057-201090079 TTTCATTTTTTGTGGTTTCTTGG + Intergenic
944735713 2:202561912-202561934 TTCCACGTTTTGTGTTTTATTGG + Exonic
944977167 2:205067112-205067134 TTTTTTTTTTTTTGGTTTATAGG + Intronic
945298372 2:208193193-208193215 TTTTATGTTTTATGTTTTTGTGG - Intergenic
945372712 2:209039509-209039531 TTTTATGTTTTGTTTTGTTTTGG + Intergenic
945648304 2:212529072-212529094 ATTTTTGTATTGTGTTTTATTGG + Intronic
945657377 2:212641864-212641886 TTTCATGTTTGTTGGTTTGTTGG + Intergenic
945704205 2:213208963-213208985 TTTTATATGGTTTGGTTTATGGG - Intergenic
945890459 2:215425539-215425561 TTGTTTGTTTTTTGGTTTTTTGG + Intronic
946585385 2:221180935-221180957 TTTTATGTATTGTGTAATATAGG - Intergenic
946598812 2:221336810-221336832 TGTTTTGTTTTGTTTTTTATGGG - Intergenic
946734608 2:222741961-222741983 TGTTATGTTTGATTGTTTATTGG - Intergenic
946980044 2:225201679-225201701 TTTTCTGTTTTCTAATTTATTGG + Intergenic
947115603 2:226767279-226767301 TTTTATCTTAAGTGGTTTTTAGG - Intronic
947292032 2:228586031-228586053 TTTTTTGTTTGTTGGTTTGTTGG - Intergenic
947366535 2:229402121-229402143 TTTTATGGTTTGTGCTTTTCTGG - Intronic
947370129 2:229437107-229437129 TTTTATGTTTTCTGTTTGTTTGG - Intronic
947510423 2:230748127-230748149 TCTTATGTTGTTTGGTTTTTTGG + Intronic
947603506 2:231468811-231468833 TTTTGTGTTTTTTGGTGTGTGGG + Intronic
947604394 2:231475110-231475132 TTTTATAATTTTTGGTTTCTTGG - Intronic
947647386 2:231753378-231753400 TTTTTTGTTTTTTGTTTTTTGGG - Intronic
947666301 2:231907961-231907983 TTTTTTTTTTTTTGCTTTATTGG + Intergenic
947930087 2:233957517-233957539 TTTTTTGTTTTTTTGTTTTTTGG - Intronic
948222310 2:236281118-236281140 TTTTTTGTTATGTGCTTTACTGG - Intergenic
948810525 2:240473469-240473491 TTTTTTTTTTTTTGGTTAATTGG - Intergenic
1168862709 20:1057443-1057465 ATTTATGTAGTGTGGTTTCTTGG + Intergenic
1169047731 20:2549057-2549079 ATTTGTGTTTTTTGGTTTTTTGG + Intronic
1169225765 20:3855708-3855730 TCTTGTATTTTGGGGTTTATAGG + Intronic
1169310710 20:4537071-4537093 TTTTATAATTTTTGGTATATAGG - Intergenic
1169497173 20:6126249-6126271 TTTTATGATTTTTTGTTTTTTGG - Intergenic
1169589836 20:7128255-7128277 TCTTTTGTTTTTTGGTTTTTGGG - Intergenic
1169653521 20:7895593-7895615 TTTTATGTTTTTTTTTTTTTTGG - Intronic
1169743728 20:8921771-8921793 TGTTTTGTTTTGTGTTTTAGAGG + Intronic
1169847155 20:10006491-10006513 TTTTATGTTTTGTTCTTTCTAGG + Intronic
1169894876 20:10492672-10492694 TTTTATGGTTTGTACTTTTTAGG + Intronic
1170063163 20:12281822-12281844 TTTTGTGTTTTTTGGATTTTTGG - Intergenic
1170865150 20:20148694-20148716 TTGGATGTTTTGTGTTTTCTAGG + Intronic
1171546100 20:26002760-26002782 TTTTCTGTTTTTAGGTTTAAGGG + Intergenic
1171870913 20:30524056-30524078 TTTTAAGTTCTGGGGTATATGGG + Intergenic
1172172413 20:32946394-32946416 TTTTTTGTTTTTTGTTTTTTTGG + Intronic
1172180193 20:32998471-32998493 GTTTTTGTTTTTTGGTTTTTGGG - Intronic
1172198749 20:33110754-33110776 TTTTTTTTTTTTTGGTCTATGGG + Intronic
1172259777 20:33553226-33553248 GTTTATGTTTTTTGTTTTAGAGG + Intronic
1172386924 20:34540486-34540508 TTTTATGGTTAGTGATTTAATGG + Intronic
1172726706 20:37049199-37049221 TTTTTTGTTTTTTGTTTTTTGGG - Intronic
1173106316 20:40138761-40138783 TTTTATGTTTTTTGGTGTATTGG + Intergenic
1173351454 20:42249288-42249310 GTTTTTGTTTTGTTCTTTATAGG + Intronic
1173740000 20:45393488-45393510 TTTTCTGTTTTTTTGTTTTTTGG - Intronic
1173791238 20:45828964-45828986 TTTATTGTTTTTTGGTTTTTTGG + Intronic
1174019994 20:47522414-47522436 TTTTTTTTTTTGTGGTTTTAAGG + Intronic
1174749406 20:53096897-53096919 TTTTGTTTTTTTTGGTTTTTGGG - Intronic
1174838081 20:53876845-53876867 CTCTTTGTTTTGTTGTTTATTGG + Intergenic
1174922528 20:54718993-54719015 TTTTTTGTTTTTTGTTTTTTTGG - Intergenic
1175256483 20:57650754-57650776 TTTCATGTTGGGTTGTTTATTGG + Exonic
1176447974 21:6837972-6837994 TTCTATGTTTTCTAATTTATTGG - Intergenic
1176766360 21:13023135-13023157 TTTTATGTTTTTTCTTTTTTTGG + Intergenic
1176826144 21:13702998-13703020 TTCTATGTTTTCTAATTTATTGG - Intergenic
1176878349 21:14158903-14158925 TTTTGTAGTTTGTGGTTTTTGGG - Intronic
1177024061 21:15899881-15899903 TTTTATGTTTTCCAATTTATTGG - Intergenic
1177123929 21:17172209-17172231 TTTTATTTTTTGTGGTGTTTTGG - Intergenic
1177137087 21:17316507-17316529 ATGTATGTTCTGTTGTTTATGGG - Intergenic
1177311614 21:19402436-19402458 TTTACTTTTTTGTTGTTTATTGG + Intergenic
1177320142 21:19510558-19510580 GTTTTTGTTTTTTGGTTTTTTGG + Intergenic
1177521361 21:22231850-22231872 TTTTATGTCTTCTTTTTTATTGG - Intergenic
1177692123 21:24524286-24524308 TTTTCTCTTTTGTTGTTTCTTGG + Intergenic
1177747358 21:25234398-25234420 TTTTAAGTTTAGGGGTATATGGG - Intergenic
1178513191 21:33224630-33224652 TTTTTTGTTTTTTGTTTTTTTGG + Intergenic
1178514946 21:33238623-33238645 TTTTATGTTTTCAGATTTAAAGG - Intronic
1178607154 21:34048615-34048637 TTTTTTGTTTTTTGTTTTTTGGG - Intergenic
1178693475 21:34770648-34770670 TTAAATGTTTTGTTGTTTTTAGG - Intergenic
1178894400 21:36547172-36547194 TCATAGGTTTGGTGGTTTATAGG + Intronic
1179470015 21:41604060-41604082 TTTTTTGTTTTTTGTTTTTTTGG + Intergenic
1179773672 21:43644616-43644638 TTTTCTGTTTTGTGTTTTTAAGG + Intronic
1180477241 22:15722712-15722734 TTTTTTGTTTTGTTTTTTATTGG + Intergenic
1180651162 22:17378293-17378315 TTTTTTGTTTTTTTGTTTTTGGG + Intronic
1180944431 22:19682867-19682889 TTTAATGTTTTGTGGAGTAAGGG - Intergenic
1180946856 22:19699772-19699794 TTTTTTGGTTTGGGGTTTTTGGG + Intergenic
1181453656 22:23040726-23040748 TTTTAGGTGGTTTGGTTTATGGG - Intergenic
1181732526 22:24857976-24857998 TTTTTTGTTTTTTGTTTTTTTGG + Intronic
1181963165 22:26637690-26637712 TTTTTTGTTTTTTTGTTTTTTGG - Intergenic
1182292665 22:29293425-29293447 TTTAAGGTTTTGAGGTTTATGGG - Intronic
1183652010 22:39161822-39161844 CTTTTTGTTTTGTTGTTTGTTGG - Intergenic
1183768944 22:39906763-39906785 TTTTTTGTCTAGTGCTTTATGGG + Intronic
1183774725 22:39956459-39956481 TTTTAAGTTTTGGGTTTTTTTGG + Intronic
1184297814 22:43536861-43536883 TTTGTTGTTTTGTTGTTTTTTGG - Intronic
1184618731 22:45656985-45657007 TTTTAGCTTGTTTGGTTTATGGG + Intergenic
949326378 3:2869602-2869624 TTATTTGTTTTGTGCTTTTTTGG + Intronic
949577264 3:5350793-5350815 TTTTAGGTTTTATGGGCTATAGG + Intergenic
949962586 3:9325282-9325304 CTTTATGTGGTTTGGTTTATGGG - Intronic
949978396 3:9481795-9481817 TTTTTTGTTTGGGGGTTTCTGGG - Intergenic
950353280 3:12378968-12378990 TTGTTTGTTTTTTGGTTTTTTGG + Intronic
950989882 3:17422145-17422167 GTTTTTGTTTTTTGGTTTTTGGG + Intronic
950991131 3:17438826-17438848 TTTTTTGTTTTGTTGTTTTGAGG - Intronic
951001350 3:17563770-17563792 TTTTTTGTTTTTTGTTTTTTTGG + Intronic
951187232 3:19727986-19728008 TTTTAAGTGGTTTGGTTTATGGG + Intergenic
952233023 3:31451714-31451736 TTTAATGTTCTGTGCATTATTGG - Intergenic
952582409 3:34850092-34850114 TTATATGTTCTGTGCTTAATTGG - Intergenic
952585488 3:34887249-34887271 TTTAATGTTTTTTGCCTTATTGG + Intergenic
952666353 3:35909401-35909423 TTTTGTGTTTTGTGCTGTATTGG + Intergenic
952718515 3:36507679-36507701 TTCTAAGTTTTCTAGTTTATTGG + Intronic
953374128 3:42414317-42414339 TTTTTTGTTTTTTGTTTTTTGGG + Intergenic
953529442 3:43726893-43726915 TGTTTCATTTTGTGGTTTATCGG + Intronic
953816261 3:46160051-46160073 TTCTAAGTTTTGTAGTTTGTGGG + Intergenic
955193405 3:56783165-56783187 TTTTTTAATTTGTGTTTTATAGG - Intronic
955246883 3:57233010-57233032 TTTTTTGTTTTTTTGTTTTTTGG - Intronic
955262301 3:57405333-57405355 TTATATGTTTTGTTGTTGTTAGG + Intronic
955285914 3:57641747-57641769 TGTTTTGTTTTGTTTTTTATAGG - Exonic
955859830 3:63316496-63316518 TTCTAGGTTTTCTAGTTTATGGG + Intronic
955908836 3:63838320-63838342 TTTTATTTTTTATGGTCTAAAGG - Intronic
955946771 3:64202429-64202451 AATTATATTTTGTGGTTTTTAGG + Intronic
956225501 3:66952974-66952996 TATTATGTCTTGTGTTGTATAGG + Intergenic
956269738 3:67438749-67438771 CTTGATGTTTTTTGGTTGATAGG - Intronic
956704857 3:71990952-71990974 TTTTGTGTGTTGTGGGTTAGAGG - Intergenic
957194532 3:77050570-77050592 TTTTTTTTTTTGTTGTTTTTTGG + Intronic
957301310 3:78394767-78394789 TTTTATTTTGTGTAGTTGATGGG + Intergenic
957431262 3:80110916-80110938 TTTTATATTTTATATTTTATTGG + Intergenic
957564661 3:81868213-81868235 ATTTTTCTTTTGTGGTTTAGTGG + Intergenic
957617631 3:82551706-82551728 ATTTATCTTTTGTTGTGTATGGG + Intergenic
957719070 3:83970790-83970812 TTTTAGGTGGTTTGGTTTATGGG + Intergenic
957841583 3:85677930-85677952 TTTTATGCTTTCTGATTCATGGG - Intronic
958087656 3:88832406-88832428 TTTTATATTTTATTTTTTATGGG - Intergenic
958505002 3:94965379-94965401 TTTTATGTTTTTTAGTCTTTAGG + Intergenic
958694270 3:97507922-97507944 TTCTAGGTTTTCTAGTTTATTGG + Intronic
958810026 3:98850328-98850350 ATTTATGTTTGTTTGTTTATTGG - Intronic
958976703 3:100675868-100675890 TTTTAGGTTTTCTAATTTATTGG + Intronic
959392971 3:105799641-105799663 TTTATTGTTTTCTGGGTTATAGG - Intronic
959519324 3:107307387-107307409 TTTTAGGTTTTATGGTTTTGGGG + Intergenic
959647491 3:108720284-108720306 TTATATGTTTTGTTGCTTTTTGG + Intergenic
959974928 3:112448178-112448200 GTTTTTGTTTTTTGGTTTTTTGG + Intergenic
960002353 3:112746205-112746227 TTTTTTGTTTTTTGTTTTTTTGG + Intronic
960042561 3:113165373-113165395 TTTTTTGTTTTTTGTTTTTTGGG + Intergenic
960222055 3:115124642-115124664 TTTTCTGTTTCTTGGTTGATTGG - Intronic
960423116 3:117473662-117473684 TTTTGTTTTTTGTGTTTTTTTGG - Intergenic
960522837 3:118675523-118675545 TAATGTTTTTTGTGGTTTATCGG - Intergenic
960767424 3:121150544-121150566 TGTTATATTTTGTGATTTACTGG + Intronic
961071901 3:123939067-123939089 TTTTTTGTTTTGTTTTTTAAAGG + Intronic
961071974 3:123940157-123940179 TTTTTTGTTTTGTTGTTTTTTGG - Intronic
961237730 3:125382131-125382153 TTTTAATTTTTGTAGTTAATGGG + Intergenic
961320896 3:126074635-126074657 TTTTTTGTTTTGTTGTTGTTTGG + Intronic
962455522 3:135561853-135561875 TTTTTTGTTTTGTTTTTTGTTGG - Intergenic
962525094 3:136230761-136230783 TTTTTTGTTTTTTGTTTTTTGGG - Intergenic
963013050 3:140792964-140792986 TTTGTTGTTTTGTGTTTTTTTGG - Intergenic
963189665 3:142455230-142455252 ATCAATGTTTTGTGGTTTTTAGG - Intronic
963325701 3:143860521-143860543 TTTTTTGTTATGTCATTTATTGG + Intergenic
963709170 3:148726647-148726669 TTTTAATTTTTGTACTTTATGGG + Intronic
963739298 3:149059304-149059326 TTTTATATTTTGTAATTCATAGG - Intronic
963894818 3:150674041-150674063 TTTTCTTTTCTGTGGTGTATAGG - Exonic
963957486 3:151271008-151271030 TTTTTTTTTTTTTGGTTTTTGGG - Intronic
963984695 3:151578297-151578319 TTTTAGGCTTTGTGGGCTATGGG + Intergenic
963997219 3:151723309-151723331 TCTTATGTTTTGAGATTTGTGGG + Intergenic
964026205 3:152078038-152078060 TTTTTTGTTTTTTGTTTTTTGGG + Intergenic
964109554 3:153074465-153074487 TTTTTTGTTTTTTTGTTTTTTGG + Intergenic
964205795 3:154173580-154173602 TTTAATGTTTAATGTTTTATAGG + Intronic
964606497 3:158565714-158565736 TTTTTTGTTTTGTTTTTTTTGGG - Intergenic
964656331 3:159070140-159070162 TTCTATGTTTTCTGGCTTGTAGG + Intronic
964797457 3:160515136-160515158 TTATAAGTTTAGTGTTTTATAGG - Intronic
965019760 3:163213690-163213712 TTTTCTGTTTTGTTTTTTTTTGG - Intergenic
965038135 3:163469011-163469033 TTTTATTTTTTTTGGTTGAGAGG - Intergenic
965084235 3:164073639-164073661 TTTTAGGTGATTTGGTTTATGGG - Intergenic
965118774 3:164523016-164523038 TTTTTTGTTTTGTTTTATATTGG + Intergenic
965356344 3:167678473-167678495 TTTTAAGTTTTTTGGCTTAAAGG - Intergenic
965375799 3:167922176-167922198 TTTGATGTTATTTAGTTTATAGG - Intergenic
965560080 3:170053364-170053386 TTTTATGTTTTTGAGTCTATTGG + Intronic
965567542 3:170136665-170136687 TTTTCTGTTATGTGGTTCTTAGG - Exonic
965875570 3:173314226-173314248 TTTTATGTTTTGAGAATTCTAGG + Intergenic
965905434 3:173699716-173699738 TTTTATGTTTTAAGGTTTAGGGG + Intronic
966046304 3:175554445-175554467 GTTTATGTTTTGGGGTATTTAGG + Intronic
966112801 3:176423952-176423974 TTTTATGATTTTTTGTTTATAGG - Intergenic
966165760 3:177014536-177014558 TTTGTTGTTTTTTGGTTTTTCGG - Intergenic
966165761 3:177014544-177014566 TTTTGTTTTTTGTTGTTTTTTGG - Intergenic
966186316 3:177230116-177230138 TTTTATGTTTTTTTTTTTTTTGG - Intergenic
966674305 3:182568797-182568819 TTTTCCTTTTTGTGATTTATAGG - Intergenic
967510657 3:190307624-190307646 TTATTTGTTTTGTGTTTCATTGG - Exonic
967718781 3:192793237-192793259 TTTTATCTTCTGTGATTAATTGG + Intergenic
967906492 3:194505352-194505374 TTTTATTTTTGATGGATTATTGG - Intergenic
968251147 3:197215655-197215677 TTTTATGGCTTGTGGCTTTTTGG - Intronic
968390280 4:187190-187212 TTTTTTGTTTTTTTGTTTTTTGG + Intergenic
968723695 4:2228263-2228285 TTTTTTGTTTTGTTTTTTGTTGG - Intronic
970048872 4:11887973-11887995 CTTTAGGTTTTCTGGTTTACAGG + Intergenic
970146850 4:13044941-13044963 TTTTATGGTTTATGGCTTGTGGG - Intergenic
970197517 4:13566781-13566803 TTTTTTATTTTTTGGTTTTTTGG - Intergenic
970388753 4:15585303-15585325 CATTCTGTTTTGTGGTTGATTGG - Intronic
970470857 4:16378305-16378327 TTTTTTGTTTTAAGGTTTAGGGG + Intergenic
970768394 4:19579458-19579480 TTGTATGTTTTTTGTTTTTTGGG + Intergenic
970783235 4:19765462-19765484 GTTTATCTTTTGTGGTTTAGTGG + Intergenic
970786199 4:19799096-19799118 TTCTATGTTTATTAGTTTATGGG - Intergenic
971066427 4:23037898-23037920 TTATATGTTTATTGATTTATTGG - Intergenic
971105077 4:23515773-23515795 TTTTTTGTTTTTTTGTTTTTTGG + Intergenic
971269553 4:25128316-25128338 TTTAATGTTGTGTGATTTAAAGG - Intronic
971276907 4:25207171-25207193 TTTTTTGTTTTTTGCTGTATTGG + Intronic
971772236 4:30911433-30911455 TTTTAGGTTTTGTGGGCCATAGG - Intronic
971779389 4:31012243-31012265 CTTTTTGTTTTGTTGTTTGTTGG - Intronic
972019293 4:34289355-34289377 TATTATGTTTGATGGTTTACGGG + Intergenic
972146236 4:36030310-36030332 TTTTTTGTTTTGTATTTTATTGG + Intronic
972237231 4:37148595-37148617 TTGTATGTTTTTTGGTTTGAGGG + Intergenic
972538181 4:40016569-40016591 ATTAATGTTTTTTGGTTTTTTGG - Intergenic
973090198 4:46126133-46126155 TTTTATAATATGTGTTTTATGGG + Intergenic
973546544 4:51988238-51988260 TTTTTTGTTTTCTGTTTGATTGG + Intergenic
973813849 4:54599911-54599933 TTTGATGTGGTTTGGTTTATGGG - Intergenic
973816140 4:54621279-54621301 TTTTGTGTTTTGTGATTTTGTGG + Intergenic
973872401 4:55179556-55179578 TTTTTTGTTTTTTGTTTTTTTGG + Intergenic
974045325 4:56893664-56893686 TATTTTGTTTTATGGTTTCTGGG + Intergenic
974183924 4:58420957-58420979 TTTTCTTTTTTGTTGTTTCTTGG + Intergenic
974613136 4:64242305-64242327 TTTTCTTTTTTGTTATTTATGGG + Intergenic
974784895 4:66607570-66607592 TTCTATGTTTAGTGATTTATGGG + Intergenic
974788459 4:66653773-66653795 TTTTAGGTTTTGTTGTAGATAGG + Intergenic
974814326 4:66985811-66985833 TTTTTTTTTTTTTGGTTTGTAGG + Intergenic
975021662 4:69498506-69498528 TTTTTTTTTTTTTGGTTGATTGG + Intronic
975303937 4:72825718-72825740 TTTTTTCTTTTTTGGTTCATAGG - Intergenic
975568986 4:75792695-75792717 TTTTATTTTTTGTTTTTTTTTGG - Intronic
975685209 4:76913894-76913916 CTGTATGCATTGTGGTTTATGGG - Intergenic
975936710 4:79589947-79589969 TTTTAGGTTTGGTGGTACATGGG - Intergenic
976016046 4:80555759-80555781 TTCTAGATTTTGTAGTTTATGGG + Intronic
976104733 4:81604647-81604669 TTTTATTTTATGGGGTTTATTGG - Intronic
976161504 4:82205127-82205149 TTTTAGGTTTTCCAGTTTATTGG - Intergenic
976356382 4:84122498-84122520 TATTATCTTTCATGGTTTATGGG + Intergenic
977069653 4:92368573-92368595 TTTTAAATTCTGTGGTTTATAGG + Intronic
977134116 4:93280818-93280840 TTCTCTTTATTGTGGTTTATTGG + Intronic
977408126 4:96626452-96626474 TTTTATGAGTTTTGATTTATAGG + Intergenic
977432331 4:96945889-96945911 TTTTCTCTTTTGTGTTTTTTGGG - Intergenic
977476573 4:97517762-97517784 GTTATTGTTTTGTGGTTAATAGG - Intronic
977619794 4:99123563-99123585 TTTTAAGTTTTGTGGGTATTAGG + Intergenic
977931375 4:102753301-102753323 CTTTATATTATGTGTTTTATTGG + Intronic
977978683 4:103297230-103297252 TTTTTTGTTTTTTGGTTTTTGGG - Intergenic
978328126 4:107581561-107581583 TTTTATCTTTGTTGGTTTAAAGG - Intergenic
978675215 4:111305684-111305706 TTTTATTTTTTGTGGTATCATGG + Intergenic
978882589 4:113724554-113724576 TTTTTTGTTTTCTACTTTATTGG - Intronic
978980007 4:114932785-114932807 TTTTATAGTTTTTGGTATATAGG - Intronic
979043480 4:115831467-115831489 TTGTATGTTTTTTGGTGTCTGGG - Intergenic
979087297 4:116428904-116428926 TTTTAATTTTTCAGGTTTATAGG + Intergenic
979251158 4:118567819-118567841 TTTTATTTTTTATTGTTAATAGG - Intergenic
979304771 4:119129955-119129977 TTTTCTGTTTTTTGTTTTTTTGG + Intergenic
979701312 4:123670729-123670751 TTGTTTGTTTTTTGGTTTTTTGG - Intergenic
979826535 4:125241715-125241737 TGTTTTGTTTTGTGGGTTTTTGG - Intergenic
980138387 4:128884330-128884352 TGTTCTGTTTTGAGGGTTATTGG - Exonic
980467831 4:133208308-133208330 TTTTATGTTGTGAGGTTTTGGGG + Intronic
980552708 4:134360612-134360634 TTTTTTGTTTTTTGGTTTTTTGG + Intergenic
980814270 4:137922755-137922777 TTTTACGTGGTTTGGTTTATGGG + Intergenic
980814933 4:137932766-137932788 TTTTAGGCTTTGTGGGTTAATGG - Intergenic
980892114 4:138826946-138826968 TATTATTATTTGTGATTTATGGG - Intergenic
980975918 4:139610370-139610392 TTTTAGGCTTTGGGGGTTATAGG + Intergenic
981139550 4:141252722-141252744 TTTTTTGTTTTTTGTTTTTTGGG - Intergenic
981177416 4:141698300-141698322 TTTTTTGTTTTGTTCTTTCTGGG + Intronic
981185228 4:141793689-141793711 TTTTCTGTTTTTTGGTGTAATGG + Intergenic
981186077 4:141805284-141805306 TTTTATAGTTTCTGTTTTATAGG + Intergenic
981256966 4:142673400-142673422 TTTTTTGTCTCCTGGTTTATTGG - Intronic
981395775 4:144247116-144247138 TTTTTTTTTTTTTGGTTGATAGG + Intergenic
981647198 4:147012864-147012886 TTTTTTTTTTTTTGCTTTATTGG + Intergenic
982340182 4:154289316-154289338 TTCTATGTTTTCTAATTTATTGG - Intronic
982409480 4:155058259-155058281 TTTTTTGTTTTGTTTTTAATTGG + Intergenic
982603935 4:157489398-157489420 TTTTATGGTTTGCCTTTTATTGG + Intergenic
982900877 4:161002143-161002165 TTGTTTGTTTTGTGTTTTATTGG - Intergenic
982933016 4:161432810-161432832 TTTTAGGTTTTCTAGTATATTGG - Intronic
983036022 4:162866728-162866750 TTTTTTGATTTTTGTTTTATGGG - Intergenic
983130627 4:164014495-164014517 TTATCTGTTTTGTGGTTGTTTGG - Intronic
983160548 4:164408641-164408663 TTTTAATTTTTGTGGGTTAATGG - Intergenic
983259707 4:165442525-165442547 TCTGATGTTTTGATGTTTATGGG - Intronic
984136379 4:175944942-175944964 TTTTTTGTTTTTTGTTTTTTCGG + Intronic
984211254 4:176851570-176851592 TTTTATGTTTTCAGTTTTTTAGG - Intergenic
984221602 4:176984329-176984351 ATGTATGTTCTGTGGTTGATGGG - Intergenic
984237605 4:177179602-177179624 TTATATTTGTTGTGTTTTATTGG + Intergenic
984246927 4:177286080-177286102 GTTTTTGCTTTGTGGTTTTTGGG + Intergenic
984297438 4:177870333-177870355 TTTTTTGTTTTTTGTTTTTTTGG - Intronic
984350374 4:178583301-178583323 TTTTAATTTTAATGGTTTATGGG + Intergenic
984655847 4:182317465-182317487 TTTTTTGTTTTGTTGTTGTTTGG + Intronic
984838309 4:184042940-184042962 TTTTTTGTTTTTTGTTTTTTTGG + Intergenic
985102463 4:186472148-186472170 TTTTTTGTTTTGGGGTGTTTTGG + Intronic
986223110 5:5788174-5788196 TTCCATGTTTTATGGTTTGTAGG + Intergenic
986340229 5:6782785-6782807 TTTTATGTTTTTTCCCTTATTGG + Intergenic
986552303 5:8971448-8971470 TTTTTTTTTTTTTGGTTTGTTGG + Intergenic
987016331 5:13823532-13823554 TTTTATTTTTTTTAATTTATGGG - Intronic
987083440 5:14446811-14446833 ATATTTGCTTTGTGGTTTATTGG + Intronic
987283315 5:16432544-16432566 TTTTATGTTTAATGATTTAACGG - Intergenic
987507083 5:18786213-18786235 TTTTTTCTTATGTGGGTTATTGG + Intergenic
987513126 5:18868293-18868315 TTTTATTTTTTCTGGTTTATAGG - Intergenic
987583137 5:19821383-19821405 TTTTTTGTTTTTTGGTTAACTGG - Intronic
988488698 5:31689051-31689073 TTTTTTGTTTTCTTGTTTTTTGG + Intronic
988711180 5:33776905-33776927 TTTTAGGTTTTCTAATTTATTGG - Intronic
988809650 5:34771898-34771920 TTTTTTGTTTTTTGTTTTTTTGG + Intronic
988938486 5:36116376-36116398 TTTTATTTTTTGTTGTTTACAGG - Intronic
989287218 5:39715976-39715998 TTTTTTGTTTTTTGTTTTTTTGG + Intergenic
989324132 5:40170687-40170709 TTTTATGTGTGGTGGTTGGTAGG - Intergenic
989336771 5:40326757-40326779 TTTTATGTGGTTTGGTTTATGGG - Intergenic
989376824 5:40772598-40772620 TTTTGTTTTTTGTGTTTTTTTGG + Intronic
989582948 5:43050537-43050559 TTCTTTCTTTTGTGGTTTTTAGG + Intergenic
989781546 5:45271231-45271253 TTTTACCTTTTGTAGTTTGTGGG + Intronic
990151851 5:52827097-52827119 TTTTTTTTTTTTTGGTTTATGGG + Intronic
990290890 5:54350454-54350476 TTTTAGGTGGTTTGGTTTATGGG + Intergenic
990462619 5:56043990-56044012 TTTTTTGCTTTGTTTTTTATGGG - Intergenic
991022238 5:61991817-61991839 TTTTGTTTTTTGTTGTTTCTTGG - Intergenic
991028455 5:62056542-62056564 TTTTAGGTTTTTTGTTTTTTTGG + Intergenic
991122068 5:63028419-63028441 TTTTTTGTTTTTTGTTTTTTTGG - Intergenic
991144167 5:63281912-63281934 TTTTTTGTTTTTTGTTTTTTGGG + Intergenic
991240612 5:64455170-64455192 TTTTATGGTTTGTGCTTTTCTGG - Intergenic
991611941 5:68458515-68458537 TTTTTTTTTTTGTATTTTATTGG - Intergenic
991619693 5:68532768-68532790 TTTTATGTTTTATTTTTTAATGG - Intergenic
991908553 5:71537132-71537154 TTTTTGGTTTTTTGGTTTTTTGG - Intronic
991908554 5:71537140-71537162 TTTTTTTTTTTTTGGTTTTTTGG - Intronic
992063183 5:73077666-73077688 TTTTTTGTTTTTTGTTTTTTTGG - Intronic
992165656 5:74048578-74048600 TTTTGTGTTCTATGGTTAATAGG + Intergenic
992220857 5:74571781-74571803 ATGTATGTCTTGTGGTTTATGGG + Intergenic
992528484 5:77633341-77633363 TTTTATGTTTCATGGCTTACTGG + Intronic
992581896 5:78187228-78187250 TTTAATTATTTGTGTTTTATTGG - Intronic
992855737 5:80859729-80859751 TTTTTTGTTTTTTGGTTTCTTGG + Intronic
992944640 5:81798033-81798055 TTTTATATTTTGTGCTACATGGG - Intergenic
993009285 5:82461215-82461237 ATGTATATTTTGTGGTTGATGGG - Intergenic
993094832 5:83470287-83470309 TTTTATATTTTGTAATTTGTAGG - Intergenic
993173899 5:84457219-84457241 TTTTATCTTTTGTTTTTTAAAGG - Intergenic
993310512 5:86325888-86325910 TTTTGTTTTTTGTGCTATATAGG + Intergenic
993405594 5:87508749-87508771 TTTTTTTTTTTTTGGTTTGTGGG - Intergenic
994264222 5:97695719-97695741 TTTTATTTTTTGTGGGTTCATGG - Intergenic
994409927 5:99394376-99394398 TTTTTTTTTTTTTGGTTGATAGG - Intergenic
994483895 5:100370900-100370922 TTTTTTTTTTTTTGGTTGATAGG + Intergenic
994820274 5:104641337-104641359 TTTTTTTTTTTTTGGTTTTTGGG - Intergenic
995096005 5:108236537-108236559 GTTTTTGTTTTGTGTTTTTTTGG - Intronic
995133314 5:108653867-108653889 TTTTGTGTTTTGTTTTTTAAAGG - Intergenic
995733332 5:115270110-115270132 TTTTATATTTTCTGTTTTGTGGG + Intronic
995819488 5:116212886-116212908 ATTTATGTCATGTGGTTTTTTGG + Intronic
995909261 5:117165963-117165985 TTTAATACTTTGTGGGTTATAGG - Intergenic
995971596 5:117978014-117978036 TTCTATGTTTCCTGATTTATTGG + Intergenic
996471730 5:123869055-123869077 TTTTATGTTTTATGCTTCACTGG + Intergenic
996640545 5:125746716-125746738 TTTTATGTAATGTGATTGATAGG + Intergenic
996885815 5:128352430-128352452 TTTTATTTTATGTGGATTAAAGG + Intronic
997138429 5:131351787-131351809 TCTTATGATTTGTGCTTTTTGGG - Intronic
997641759 5:135453080-135453102 TTTTTTTTTTTTTGGCTTATAGG + Intergenic
997823264 5:137084712-137084734 TTTTCTGTTTTTTGTTTTTTGGG - Intronic
998860225 5:146436320-146436342 TCTTTTCTATTGTGGTTTATAGG - Intergenic
998988403 5:147788104-147788126 TTTTATTTTTAGTCATTTATGGG + Intergenic
999119094 5:149195240-149195262 TGTGATGTTTTGTAGGTTATTGG - Intronic
999162608 5:149516344-149516366 TTTTATTTTTTGTTTTTTTTGGG - Intronic
999465787 5:151803294-151803316 TTTTATTTTTTATTTTTTATTGG + Intronic
999562710 5:152821900-152821922 TTTTTTTTTTTGTGGATTCTTGG - Intergenic
999579707 5:153023534-153023556 TGTAATGTTAGGTGGTTTATTGG - Intergenic
999689477 5:154134383-154134405 TTTTTTGGTTTTTGGTTTTTTGG + Intronic
1000200642 5:159006765-159006787 TTTTATGTTTTGAGTATTTTTGG - Intronic
1000346269 5:160316736-160316758 TTTTGTGTTTTGTTGTTTTATGG + Intronic
1000413468 5:160958772-160958794 TTTTATTTTTTGTGGATTCAAGG + Intergenic
1000559695 5:162770619-162770641 ATTTATCTTTTGTGCTTTCTGGG - Intergenic
1000567813 5:162872387-162872409 TTATATGTTTTGTTTTGTATTGG + Intergenic
1000657097 5:163892840-163892862 TTTTTTTTTTTTTGGTTTAAAGG - Intergenic
1001093275 5:168757172-168757194 TTTTACATTTTGTGGTTTCCTGG - Intronic
1001207999 5:169781950-169781972 TGTTTTGTTTGTTGGTTTATGGG + Intronic
1001477417 5:172060441-172060463 TTTGGGGTTTTGTGGTTTTTTGG - Intronic
1001697948 5:173686263-173686285 TTTTATTTTTTATTTTTTATAGG + Intergenic
1002145502 5:177177509-177177531 TTTTGTTTTTTGTTGTTTTTGGG - Intronic
1002681210 5:180966413-180966435 TTTTTTGGTTTTTGGTTTTTTGG - Intergenic
1003201751 6:3967705-3967727 TTTTAGGTGGTTTGGTTTATGGG + Intergenic
1003565872 6:7221566-7221588 TTTTATGTCTTTTGACTTATAGG + Intronic
1003593368 6:7454211-7454233 TTTTTTCTTCTGTGGTTTCTAGG + Intergenic
1003734247 6:8859708-8859730 TTCAATCTTTTGTGGTTTGTGGG - Intergenic
1003997260 6:11555382-11555404 ATTTTTGTTTTGTTGTTTTTTGG + Intronic
1004652287 6:17622102-17622124 TGTTTTGTTTTGTGTTTTTTTGG + Intronic
1004695260 6:18027288-18027310 TTTTTTGTTTTTTTGTTTTTTGG - Intergenic
1004819112 6:19346993-19347015 TTTTATGGATTGTGCTTTTTAGG - Intergenic
1004833453 6:19502828-19502850 TTTTCTGTTTTGTTCTTTGTGGG + Intergenic
1004844869 6:19629459-19629481 TTTTTTTTTTTGTCTTTTATTGG - Intergenic
1004885257 6:20044842-20044864 TTTTTTGTTTTTTTGTTTTTGGG - Intergenic
1004951532 6:20678204-20678226 TTTTATGTTATTTGGTGCATAGG + Intronic
1005069198 6:21848966-21848988 TTTTGTCTTTTGGGGTTTTTCGG - Intergenic
1005191228 6:23227162-23227184 TTTTTTGTTTTTTGTTTTTTTGG + Intergenic
1005626894 6:27670775-27670797 TGTTTTCTTTTGTGGTTTGTTGG + Intergenic
1005676821 6:28163370-28163392 TTTGATGTTTTGTGGTCTTCTGG + Intergenic
1005728225 6:28670652-28670674 TTTTGTTTTTTGGGGTTTTTTGG + Intergenic
1006266876 6:32932890-32932912 TTGTAGGTTTTTTGTTTTATAGG - Intergenic
1006271863 6:32971364-32971386 TTTTAGCTTTTGTGGTCTTTGGG + Intronic
1006679031 6:35784052-35784074 TTTTTTGTTTTTTGTTTTTTGGG + Intronic
1006691429 6:35890276-35890298 TCTTCTGTTTTCTGGTTTTTTGG - Intronic
1006875459 6:37291592-37291614 TGATATGTTTTGTGGTTTGATGG + Intronic
1006909801 6:37556577-37556599 TTTTATGTTTTATGTTTTTGGGG - Intergenic
1006938709 6:37737059-37737081 TTTTTTGTTTTGTTTTTTAATGG - Intergenic
1007346358 6:41232341-41232363 TTTTATCTTTTTTGATTTATAGG + Intronic
1007580086 6:42952986-42953008 TTTTAGGTGGTTTGGTTTATGGG - Intergenic
1007721704 6:43889072-43889094 TTTTATATTTTGTCTTTTCTTGG + Intergenic
1007845015 6:44747186-44747208 TGTTGTTTTTTGTGGTTTTTTGG - Intergenic
1007910198 6:45505732-45505754 TTTTATGTTTTGTGGTTTATAGG + Intronic
1008132569 6:47735571-47735593 TTTTATGTTTTGTTTTATAGTGG - Intergenic
1008184161 6:48370202-48370224 TTTTTTGTTTTGTTTTTTGTTGG + Intergenic
1008211652 6:48731529-48731551 TTTTTTGTTTTCTATTTTATTGG - Intergenic
1008290995 6:49716098-49716120 TTTTAGGTGGTTTGGTTTATGGG + Intergenic
1008402831 6:51083933-51083955 TTTGATGTTTGTTGGTTTAAAGG + Intergenic
1008461069 6:51772779-51772801 TTTTATTTTCAGGGGTTTATGGG - Exonic
1008729956 6:54469734-54469756 TTTTATGTTTTCTGACATATTGG - Intergenic
1008751783 6:54743038-54743060 TTTTAGGTTTTCTGATTTGTTGG + Intergenic
1008980640 6:57479747-57479769 GTGTATGTGTTGTGGTTTTTTGG + Intronic
1009168746 6:60372703-60372725 GTGTATGTGTTGTGGTTTTTTGG + Intergenic
1009305660 6:62086594-62086616 ATTTATGTTGTGTGGTTCAAGGG - Intronic
1009327795 6:62375161-62375183 TTTTTTTTTTTTTGGTTCATTGG + Intergenic
1009506173 6:64483114-64483136 TTTCAGGCTTTGTGGGTTATGGG + Intronic
1009666269 6:66685103-66685125 TTTTAAGTGGTTTGGTTTATCGG + Intergenic
1009794752 6:68452897-68452919 TTTTTTTTTTTTTGGTTAATAGG + Intergenic
1009839249 6:69046284-69046306 TTTGATGTCTTGGGGTTTAGAGG - Intronic
1009966059 6:70580117-70580139 TTTTATTTTTTGTAGATTACTGG - Intronic
1010095846 6:72044347-72044369 TTTTATGTTTTATGCTTTTGTGG - Intronic
1010228279 6:73512097-73512119 TTTTTTGTTTTGTTTTTTTTGGG - Intergenic
1010320360 6:74501356-74501378 TTTTATTTCTTGTTGTTTGTAGG + Intergenic
1010410179 6:75552551-75552573 TTTTTTGATTTTTGGTTTTTTGG + Intergenic
1010619069 6:78052017-78052039 TTTTATATTTTGTGCTTTTAGGG + Intergenic
1010752449 6:79631003-79631025 GGTTCTGTATTGTGGTTTATTGG - Intergenic
1010795078 6:80108868-80108890 ATTTTTGTTTTTTGGTTTTTTGG - Intronic
1010978231 6:82340775-82340797 TTTTTTTTTTTATGGCTTATAGG - Intergenic
1011031450 6:82928286-82928308 TTTTATTTTTAGTGGTTGACAGG - Intronic
1011376993 6:86699119-86699141 TTTTATTTTTACTGATTTATAGG - Intergenic
1011733333 6:90288849-90288871 TTTTTTGTTTTTTGTTTTTTTGG - Intronic
1012241707 6:96880209-96880231 TCTTATGTTTTGAGGATTCTTGG + Intergenic
1013262631 6:108461410-108461432 CTTTTTGTTTTGTATTTTATAGG + Intronic
1013525565 6:110970373-110970395 ATTAATGTTTTTTGGTTTTTTGG - Intergenic
1013570743 6:111422354-111422376 TTTTAGGTTTTGAGGGTTGTAGG - Intronic
1013684682 6:112565665-112565687 TTTCAGGTGTTTTGGTTTATTGG + Intergenic
1013708323 6:112866094-112866116 TTTTCTGTTTAGTTGTTTTTAGG + Intergenic
1013871552 6:114768183-114768205 ATGTATGTTATGTGGTTGATGGG + Intergenic
1013883249 6:114930862-114930884 ATTTATATTTTGTGGTTATTGGG + Intergenic
1013942043 6:115676284-115676306 TTTTATGTGTTGGGATGTATTGG + Intergenic
1014005114 6:116409273-116409295 TTTTTTGTTTTTTTGTTTTTTGG + Intronic
1014346836 6:120281185-120281207 ATTTATTTTGTGTGTTTTATTGG + Intergenic
1014823682 6:126023159-126023181 TTTAATGTTTAATGGTTTAATGG - Intronic
1015141110 6:129932834-129932856 TTTTCTGTTTTGTTATATATAGG - Intergenic
1015370827 6:132450329-132450351 TTTTCTGTTTTGTGATATATTGG + Exonic
1015706081 6:136089040-136089062 TCTTGTGTTTTGCGGTTTCTAGG - Intronic
1015802731 6:137077117-137077139 TTTTTTGTTTTGTTCTTTAATGG - Intergenic
1016133420 6:140506832-140506854 TTTTTTGTTTTTTTGTTTTTTGG - Intergenic
1016252546 6:142062429-142062451 TATCATGTTTTGTCGATTATAGG - Intronic
1016334076 6:142984858-142984880 TTCTATTTTCTGTAGTTTATAGG + Intergenic
1016341638 6:143067804-143067826 TTTTCTGTTTTTTGTTTTTTGGG + Intronic
1016692123 6:146950158-146950180 TTTTTTGTTTTTTGTTTTTTTGG - Intergenic
1017120902 6:151023006-151023028 TTTTATGTTTTTTTGTTTGTTGG + Intronic
1017214642 6:151896146-151896168 TTTTTTGTTTTGTTCTTTCTTGG + Intronic
1017289518 6:152719885-152719907 TAATATGTTTTGTGATTTTTAGG - Intronic
1017665759 6:156719199-156719221 TTTTTTGTTTTTTTGTTTTTTGG + Intergenic
1017711732 6:157175032-157175054 TTTTTTGTTTTTTGTTTTTTTGG + Intronic
1017901927 6:158725668-158725690 TTTTTTGTTTTTTGTTTTTTTGG + Intronic
1018322106 6:162622297-162622319 TTTTTTGTTTTGTTTTTTTTTGG + Intronic
1018344297 6:162884806-162884828 TTTTAGGTTTAGAGGTTTTTAGG - Intronic
1018918238 6:168151524-168151546 TTTTATGTTTTTTGGGATTTGGG - Intergenic
1019363625 7:618924-618946 CTTTATGGTTTGTGCTTTGTGGG + Intronic
1019897426 7:3993603-3993625 TTTTATTCTTTGTGCTTTAAGGG - Intronic
1020180222 7:5916507-5916529 TTTTTTTTTTTTTGGTTTTTTGG + Intronic
1020258353 7:6515469-6515491 CTATATGTTTTTTGGTTTTTTGG - Intronic
1020302708 7:6808375-6808397 TTTTTTTTTTTTTGGTTTTTTGG - Intronic
1020647246 7:10829857-10829879 TTTTAGGTGGTCTGGTTTATGGG + Intergenic
1020664987 7:11029850-11029872 TGTTATGTTTTTTCTTTTATTGG + Intronic
1020714904 7:11660684-11660706 TGTAATTTTTTGTGGTATATGGG - Intronic
1020978991 7:15044380-15044402 TTTTATGTTTTGGATTTTGTTGG + Intergenic
1021056867 7:16060095-16060117 TTTTTTGTTTTTTGTTTTTTTGG + Intergenic
1021080876 7:16362973-16362995 TTTTATATTTTCAAGTTTATGGG - Intronic
1021264547 7:18503956-18503978 TTTTTTGTTTTCTGGATTTTGGG - Intronic
1021346662 7:19537587-19537609 TTTTTTGTTTTTTGTTTTTTTGG - Intergenic
1021491726 7:21226385-21226407 TTTTATGTGTTGTGGTTCATTGG + Intergenic
1021690245 7:23223958-23223980 TTTTTTGTTTTTTGTTTTTTTGG + Intergenic
1021832333 7:24627746-24627768 TTTTAGATTTTCTAGTTTATTGG - Intronic
1022698325 7:32731748-32731770 TTTTATGTTTTGCTGTCTTTTGG + Intergenic
1022835800 7:34113352-34113374 TATCTTTTTTTGTGGTTTATAGG + Intronic
1022876553 7:34538586-34538608 GTTTATGTTTTGTTTTTTAGTGG + Intergenic
1023111551 7:36817633-36817655 TTTTCTATTTTTTGGTTTGTTGG - Intergenic
1023490600 7:40735889-40735911 TTTTCTGTTTGGTGGTTTTTGGG - Intronic
1023711864 7:43003343-43003365 TTTTATGTTTTGTACTCTATGGG + Intergenic
1023730890 7:43191016-43191038 CTTTTTGTTTTGTGATTTCTGGG - Intronic
1023910792 7:44554805-44554827 TTTTTTGTTTTGTTTTTTTTTGG - Intergenic
1023933183 7:44719570-44719592 TTTTTTGTTTTTTGGTTTTTGGG + Intergenic
1023973730 7:45011521-45011543 TTTTATGTTTTATTTTTTAATGG + Intronic
1023990742 7:45126858-45126880 TTTTTTTTTTTGTAGTTTTTGGG + Intergenic
1024830245 7:53444827-53444849 TTTTCTGTTCTTTTGTTTATAGG + Intergenic
1024869330 7:53943606-53943628 TTCTAAGTTTTGACGTTTATGGG + Intergenic
1024997326 7:55282106-55282128 TTTTAGGTGGTTTGGTTTATGGG - Intergenic
1025738166 7:64173441-64173463 TTTTATGTTTTGTTGGATTTTGG - Intronic
1026478795 7:70761313-70761335 TTTTCTGTTTTTTGTTTTAGAGG - Intronic
1026569024 7:71513376-71513398 TTTTTTGTTTTTTTGTTTTTTGG + Intronic
1027279457 7:76595580-76595602 TTTTCTGTTTTGTGTTTGCTTGG - Intergenic
1027339197 7:77187779-77187801 TTTTAGGTGGTTTGGTTTATGGG - Intronic
1027707652 7:81554631-81554653 TTTTAGGTGGTTTGGTTTATGGG + Intergenic
1027744125 7:82052085-82052107 TTTTCTGTTTGGTGGCTTCTGGG + Intronic
1027864329 7:83627572-83627594 TTTTCTGTTTGTTGGTTTAAAGG + Intronic
1028051730 7:86196530-86196552 TTTTTTGTTTTTTGTTTTTTTGG + Intergenic
1028107227 7:86893100-86893122 TTTTATGTTTTTTTTTTTAAAGG - Exonic
1028372846 7:90113967-90113989 TTTTTGGTTTTGGGGTTTTTTGG + Intergenic
1028465947 7:91151864-91151886 TTTTCTGTTTTGGGCTTGATGGG - Intronic
1028882795 7:95898928-95898950 GTCTTTGTGTTGTGGTTTATAGG - Intronic
1030115484 7:106059372-106059394 TTTTATGATTTGTGATTTTTTGG - Intergenic
1030144481 7:106339777-106339799 TTTTAGGTGGTTTGGTTTATGGG + Intergenic
1030437284 7:109539186-109539208 GTTTTTGTTTTTTGGTTTTTTGG + Intergenic
1030585057 7:111407385-111407407 TTTTATGTTGTGTTGCTTTTAGG - Intronic
1031033365 7:116759756-116759778 TTTTATGTTTGTTGGTTGGTTGG + Intronic
1031237935 7:119199993-119200015 TTATATATTCTGTGGTTGATGGG - Intergenic
1031287770 7:119893177-119893199 TTGTAGGTTTTATAGTTTATTGG - Intergenic
1031428009 7:121631253-121631275 TTTTTTGTTTTTTGTTTTGTGGG + Intergenic
1031687868 7:124754418-124754440 CTTTATGATTTGTATTTTATGGG - Intronic
1032394568 7:131580094-131580116 TTTTTTGTTTGTTGGTTTGTTGG - Intergenic
1032411758 7:131699034-131699056 TTTTTTGTTTGTTTGTTTATGGG - Intergenic
1032596012 7:133241263-133241285 TTTTACATTTTGTGCTTTGTGGG - Intergenic
1032698211 7:134356057-134356079 TTTTGTGTTTTGTGTTTTTGTGG - Intergenic
1032929105 7:136645222-136645244 TTTTGTTTTTTGTTGTTTCTTGG - Intergenic
1033072343 7:138215534-138215556 TTTTATGTGGTTTGGTTTATGGG - Intergenic
1033238113 7:139654536-139654558 TTTTTTGCTTTGGGGTTTTTTGG - Intronic
1033295004 7:140124461-140124483 TTTTATGTTTTGTTCCTTAGAGG - Intronic
1033535287 7:142306613-142306635 TGTTTTGTTTTGTGTTTTACAGG - Intergenic
1033622395 7:143073492-143073514 TTGTATTTTTTCTTGTTTATTGG - Intergenic
1033675376 7:143536147-143536169 TCTTATGTTTTGTAGTTTCAAGG + Intergenic
1033696461 7:143793291-143793313 TCTTATGTTTTGTAGTTTCAAGG - Intergenic
1033701994 7:143847931-143847953 TTTTAGGTTTTCCAGTTTATTGG - Intergenic
1033787983 7:144757144-144757166 TTTTTTGTTTTTTTGTTTTTTGG + Intronic
1033792398 7:144806501-144806523 TTTTATGCTTTTAGATTTATTGG - Intronic
1034085955 7:148322773-148322795 TGTTTTGTTTTGTTGTTTTTTGG + Intronic
1034129459 7:148701506-148701528 TTTTGTGTTTGGTGTTTTTTTGG + Intronic
1034289276 7:149915527-149915549 TTTTTTGTTTTCTGGTCAATTGG + Intergenic
1034661795 7:152777299-152777321 TTTTTTGTTTTCTGGTCAATTGG - Intronic
1034727884 7:153356967-153356989 TTTATTGTTTTCTGTTTTATAGG - Intergenic
1034864007 7:154624998-154625020 ATTTATGTTGTGTGGATTAATGG + Intronic
1035425829 7:158772278-158772300 TTTTAGGTGCTGTGGTTTACTGG - Intronic
1035734658 8:1879379-1879401 TTTTATGTATTTTTATTTATTGG + Intronic
1036492046 8:9236799-9236821 TCTTATTTTTGGTGGTATATTGG - Intergenic
1036559061 8:9886044-9886066 TTTTATTTTTTGTGTGTGATTGG + Intergenic
1036574010 8:10007884-10007906 TTTTCTGTTTTTTTTTTTATGGG + Intergenic
1036579122 8:10056189-10056211 TTTTTTTTTTTTTGGTGTATGGG - Intronic
1036693893 8:10962221-10962243 TATTATGTTTTGGGGTTTTAGGG - Intronic
1037021422 8:13976526-13976548 TTTTATCTTTTCTGGTCTTTTGG - Intergenic
1037180477 8:15999279-15999301 TTTTATGATTTCTGGTTTATGGG + Intergenic
1037452717 8:19032941-19032963 TTTTTTGTTTTGTTTTTTACTGG - Intronic
1037457320 8:19076418-19076440 TTTTATTTTTAGTAGTTTTTCGG - Intronic
1037638087 8:20718546-20718568 TTTTATGTTTTATTGTTATTAGG - Intergenic
1038464155 8:27744592-27744614 TTATAGGTTTTGTGGAATATTGG - Intronic
1038785518 8:30611192-30611214 TGTTTTGTTTTGTGGTTAAGTGG - Intronic
1038786867 8:30625613-30625635 TTTTTTGTTTTTTGTTTTAAGGG + Intronic
1038826088 8:31003771-31003793 TTTTTTGTTTTTTTGTTTTTTGG - Intronic
1039591345 8:38752499-38752521 TTTTTGGTTTTGGGGTTTTTGGG - Intronic
1039687519 8:39820889-39820911 CTATATGTTTTGGTGTTTATGGG + Intronic
1039809183 8:41029364-41029386 TTTTTTTTTTTTTGGTTTTTTGG + Intergenic
1040044557 8:42949375-42949397 TTTTATTTTTTGTGTTTGACCGG + Intronic
1040462905 8:47666532-47666554 TTTAATGTTGTATGGTTTTTGGG + Intronic
1040502915 8:48021055-48021077 TTTTATGTTTTATCTATTATAGG + Intronic
1040847642 8:51860775-51860797 TATTATGGTTTATGATTTATAGG - Intronic
1040881845 8:52213798-52213820 TTTTATGTTATCTGGTTTAGTGG - Intronic
1041078517 8:54191029-54191051 TTTTATGTTTTGAATTTTAGAGG + Intergenic
1041141997 8:54830516-54830538 TCTTATGCTTTGTGTTTTCTTGG + Intergenic
1041302296 8:56424980-56425002 TTTTTTGTTTGGTGGTTTGTTGG - Intergenic
1041546426 8:59048471-59048493 TTATATGTTTTATGCTTTTTGGG - Intronic
1041604830 8:59769168-59769190 TTTTAGGTGGTTTGGTTTATGGG - Intergenic
1041944667 8:63427621-63427643 TTTTATGATGGGTGGTTTATTGG + Intergenic
1042109916 8:65370090-65370112 ATGTATATTTTGTGGTTGATGGG - Intergenic
1042281454 8:67061205-67061227 TTTTATAATTTCTGGCTTATGGG + Intronic
1042371747 8:67999469-67999491 TTTTTTTTTTTTTGGTTTGTTGG - Intronic
1042541408 8:69910909-69910931 TTCTAGATTTTCTGGTTTATTGG - Intergenic
1042950572 8:74197287-74197309 ATTTATATTATGTGCTTTATGGG + Intergenic
1043217273 8:77607568-77607590 CTTTATGTTTTGCAGTTGATGGG + Intergenic
1043235947 8:77866957-77866979 TTTTATTTGTTTTGGTTTATGGG + Intergenic
1043642257 8:82469625-82469647 TTTTATATTATTTTGTTTATTGG + Intergenic
1043686968 8:83099061-83099083 TTTTTTGTTTTTTGCTTTTTTGG + Intergenic
1043702165 8:83302344-83302366 TTTTATGAGTTGTGATTTCTAGG + Intergenic
1043746908 8:83885857-83885879 TTTTCAGTTGTGTGGTTTGTGGG - Intergenic
1043885103 8:85589937-85589959 TTTTATGTGTTTCTGTTTATTGG - Intergenic
1044286319 8:90415125-90415147 TTTTTTGTTTTTTGTTTTTTGGG - Intergenic
1044475934 8:92626593-92626615 TTTTCTTTTTTTTGGTTTAGAGG + Intergenic
1045079819 8:98613356-98613378 TTTTATCTTTTTTGTTTTTTTGG - Intronic
1045084873 8:98671577-98671599 TTTTTTGTTTTTTGTTTTTTTGG + Intronic
1045145389 8:99337761-99337783 TTTTATGATTAGTGCTTTTTTGG + Intronic
1045355461 8:101384709-101384731 TTTTATGTGCTTTGTTTTATTGG - Intergenic
1045458560 8:102406717-102406739 TTTTTTGTTTTTTTGTTTTTTGG + Intronic
1045458959 8:102411170-102411192 TTTTATGTTTTGTCTTTTATAGG - Intronic
1045613553 8:103877521-103877543 GTGTATGTTTTGTTGGTTATAGG + Intronic
1046073282 8:109284455-109284477 ATTTATATTCTGTGGTTGATGGG - Intronic
1046409173 8:113816775-113816797 TTTTTTTTTTTTTGGTTTGTAGG + Intergenic
1046427138 8:114068889-114068911 GTTCATGGTTTATGGTTTATGGG + Intergenic
1046472613 8:114696980-114697002 TTTTATGGATTCTGTTTTATTGG - Intergenic
1046479695 8:114799907-114799929 TTTTATTTATGGTGGCTTATTGG + Intergenic
1046522429 8:115342596-115342618 TTTTATGCTTTGCAGTGTATTGG + Intergenic
1046728626 8:117701057-117701079 TTTTATTTTTTGAGATTTATGGG - Intergenic
1046767505 8:118085483-118085505 TTTTTTTTTTTTTGGTTGATTGG + Intronic
1046809085 8:118513487-118513509 TTTTATGGTTTGTTGATTGTTGG - Intronic
1046954043 8:120045370-120045392 TTTTATCTTTTATGTTTTTTAGG + Intronic
1047121676 8:121911756-121911778 TTTTTTTTTTTTTGGTTGATAGG - Intergenic
1047128012 8:121984875-121984897 TTTTATGATTTGTGTTTTACTGG - Intergenic
1048042447 8:130744412-130744434 TTTTTTGTTTTCTGTTTTTTGGG - Intergenic
1048654305 8:136518385-136518407 TTGTATGTTTTGTTGTTTGCTGG + Intergenic
1049098932 8:140565454-140565476 TTTTTTGTTTTTTGGTTTTTGGG - Intronic
1049125789 8:140786532-140786554 TTTTAGGTTTTATGGTTTTGTGG + Intronic
1049308862 8:141922819-141922841 TTTTTTGTTTGTTGGTTTTTTGG + Intergenic
1049648535 8:143750810-143750832 TTTTATTTTTTGTTTTTTAGAGG - Intergenic
1049863314 8:144916133-144916155 TTTTTTGTTTTTTGTTTTTTTGG - Intergenic
1050402555 9:5271396-5271418 TTTTATGTTTACAGGTTCATAGG + Intergenic
1050548853 9:6732037-6732059 TTTTAGGTGGTTTGGTTTATGGG - Intronic
1050582121 9:7069787-7069809 AGTAATGTATTGTGGTTTATAGG + Intronic
1050688014 9:8193306-8193328 ATGTATATTTTGTGGTTGATGGG - Intergenic
1050815621 9:9808176-9808198 TATTATGTTTTATAGGTTATTGG + Intronic
1050823734 9:9916348-9916370 TTTTATTATTTGTGGTTGGTTGG - Intronic
1050916869 9:11147059-11147081 TTTTATACTTTTAGGTTTATAGG - Intergenic
1051048450 9:12902877-12902899 TATTTTGTTTTGTTATTTATAGG + Intergenic
1051090164 9:13397479-13397501 TTTTTTGTTTTTTGTTTTACTGG + Intergenic
1051271648 9:15361058-15361080 TTTTAGGTTTTATGGCTGATTGG - Intergenic
1051784563 9:20728249-20728271 TTTTATGTTTTTTGGATTTTGGG + Intronic
1051912293 9:22167312-22167334 TTTGGGGTTTTGTGGTTTTTGGG - Intergenic
1051912295 9:22167320-22167342 TTTTTTGTTTTGGGGTTTTGTGG - Intergenic
1052162200 9:25277400-25277422 ATTTTTGTTTTGTGGTTGAGTGG - Intergenic
1052231541 9:26160394-26160416 TTTTGTGCTTATTGGTTTATGGG - Intergenic
1052369614 9:27648983-27649005 TTTTTTTTTTTTTGGTTTGTAGG - Intergenic
1052472438 9:28916797-28916819 TTTTATACTTTTTGGTTTACAGG + Intergenic
1052505786 9:29351906-29351928 TTTTTTGTTTTTTGTTTTTTTGG - Intergenic
1052535720 9:29744140-29744162 TTTTTTTTTTTTTGGTATATTGG + Intergenic
1052583422 9:30391692-30391714 TTTTATGTTTTCTGTTTTCTTGG - Intergenic
1052846064 9:33337531-33337553 TTTTATTTTTTGAGTTTTAAAGG + Intronic
1053124611 9:35570061-35570083 TTTTCTGTTTTCTGATTTATTGG - Intergenic
1053228263 9:36381160-36381182 TTTTATGTTTTTATGTTTAGAGG - Intronic
1053750896 9:41253630-41253652 TATTATTTTTATTGGTTTATTGG - Intergenic
1053798702 9:41749411-41749433 TTTTCTGTTTTTAGGTTTAAGGG - Intergenic
1054187117 9:61961456-61961478 TTTTCTGTTTTTAGGTTTAAGGG - Intergenic
1054466236 9:65496618-65496640 TTTTCTGTTTTTAGGTTTAAGGG + Intergenic
1054651392 9:67627066-67627088 TTTTCTGTTTTTAGGTTTAAGGG + Intergenic
1054930721 9:70632370-70632392 TTTTATGTTATATGGATTAAGGG - Intronic
1055055449 9:72019422-72019444 TTTTCTGGTTTTTGGTTTTTGGG + Intergenic
1055128323 9:72745538-72745560 TTATATGTTTTGTATTCTATAGG + Intronic
1055316382 9:75038443-75038465 TTTTGTGTTTTAAGTTTTATTGG - Intergenic
1055546846 9:77385562-77385584 TTTTATGTTTTGTGTAATAAAGG + Intronic
1055970577 9:81907856-81907878 TTTTATGTCCTTTGGTTTATGGG - Intergenic
1056408075 9:86295851-86295873 TTTTTTGTTTTTTGTTTTTTCGG + Intronic
1056614611 9:88153137-88153159 TTTTATGTATTGTGCTTTGGGGG + Intergenic
1057174444 9:92985781-92985803 TTTTCTGTTTTAAGGTTTAGGGG + Intronic
1057697303 9:97333517-97333539 TTTTTTTTTTTTTGGTTTGTAGG + Intronic
1057800766 9:98190439-98190461 TTATATGTTATGTGTTTTTTTGG + Intronic
1057805687 9:98218161-98218183 TTTTGTGCTTTGTGCTTTAAAGG - Intronic
1057827866 9:98384600-98384622 TTTTATTTTTTTTTGTTTTTTGG - Intronic
1057832602 9:98418562-98418584 TTTTTTGTTTTTTGGATTTTTGG - Intronic
1058061300 9:100499446-100499468 TTTTATTTTCTGTGGTTAAATGG + Intronic
1058223354 9:102329762-102329784 TTTAAAGTTTTGTGTTTTGTAGG - Intergenic
1058414399 9:104771097-104771119 TTTTAGAGTTTGTTGTTTATAGG + Intronic
1059088161 9:111327270-111327292 TTTTGTGTTTTGTGGTTGTGAGG - Intergenic
1059704693 9:116811098-116811120 TTTTGTATTTTGTATTTTATTGG + Intronic
1060559181 9:124528744-124528766 TTTTAGGTTTTTTGGTTGGTTGG - Intronic
1060791439 9:126488335-126488357 TTTTTTTTTTTTTGGTTTAATGG - Intronic
1203521216 Un_GL000213v1:46560-46582 TTCTATGTTTTCTAATTTATTGG + Intergenic
1185592906 X:1290170-1290192 TTTTGTGTTTTGTGTTTTTGTGG + Intronic
1186085454 X:5985015-5985037 TTCAATGTTTTGTGTTTTTTAGG - Intronic
1186144074 X:6607439-6607461 TTTTAAATTTTGGGGTTTTTTGG + Intergenic
1186331695 X:8541417-8541439 TTTTTTGTTTTTTTGTTTTTGGG - Intronic
1186378657 X:9034038-9034060 TTTTTTGTTTTGTTTTTTTTGGG - Exonic
1187041021 X:15595990-15596012 TTTTATATTTTGTTATGTATAGG + Intronic
1187069750 X:15876628-15876650 TTTTCTGTTTTTTGTTTTTTCGG + Intergenic
1187085024 X:16033358-16033380 TATTATGGTTTGTGGTGAATTGG + Intergenic
1187214398 X:17262450-17262472 TTTTATTTTTTATAGTTTTTGGG + Intergenic
1187344667 X:18451871-18451893 ATTAATGTTTAGTGGTTGATAGG + Intronic
1187912965 X:24127756-24127778 TTTTTTGTTTTTTGTTTTTTTGG + Intergenic
1188487289 X:30696715-30696737 TTGTTTGTTTTTTGGTTTTTTGG - Intronic
1188598690 X:31933510-31933532 TTTTTTGTTTTGTTGTCTTTTGG + Intronic
1189092374 X:38099366-38099388 TTTTATGTTTTGCTCTTTCTTGG - Intronic
1189758426 X:44296100-44296122 TCTTATGCTTTGTGGGATATAGG - Intronic
1190041709 X:47077646-47077668 TGTTTTGTTTTGTTGTTTTTTGG + Intergenic
1190175540 X:48146024-48146046 TTTTTTGTTTTTTGGTTTTTTGG - Intergenic
1190307408 X:49092941-49092963 TTTTTTGTTTTGTTTTTTAGAGG + Intronic
1190508924 X:51157265-51157287 TTTTTTGTTTTTTTGTTTTTTGG - Intergenic
1190574537 X:51819680-51819702 TTTTATGTATTGTGGGTATTAGG + Intronic
1190599138 X:52071340-52071362 TTATAATTTTTTTGGTTTATAGG + Intergenic
1190609686 X:52182733-52182755 TTATAATTTTTTTGGTTTATAGG - Intergenic
1191147157 X:57178922-57178944 TTGTATGTTTTCTGATTCATGGG - Intergenic
1191244665 X:58216697-58216719 ATTTATGTTGTGTGGATTAATGG + Intergenic
1191582230 X:62776497-62776519 TTTTGTTTTTTGTGGTTAACTGG + Intergenic
1191598006 X:62969166-62969188 TTTTATGTTTTTTGATTGCTTGG - Intergenic
1191606449 X:63067717-63067739 TTCTAGATTTTGTAGTTTATTGG - Intergenic
1191906297 X:66094354-66094376 TTTTATGTTTTGTTTTGTTTTGG - Intergenic
1191990455 X:67029548-67029570 TTCTAGATTTTGTAGTTTATTGG - Intergenic
1192020258 X:67383207-67383229 TTTTGTGTTTTGGGGGTTTTTGG - Intergenic
1192671978 X:73154333-73154355 TTTTAGGATGTTTGGTTTATGGG - Intergenic
1192678396 X:73224934-73224956 TTTTTTTTTTTGTGGTGTAGTGG + Intergenic
1192810159 X:74540199-74540221 GTTTATGTTCTGTTGTTTGTGGG + Intergenic
1192815236 X:74583735-74583757 TTTTTTGTTTTTTTGTTTTTTGG - Intergenic
1192830462 X:74745735-74745757 TGTTTTATTTTGTGTTTTATAGG + Intronic
1192964662 X:76164618-76164640 TTTTTTTTTTTTTGGTTTTTGGG - Intergenic
1193024871 X:76835704-76835726 ATATATATTTTGTGGTTGATGGG + Intergenic
1193064370 X:77243488-77243510 TTTTAAGTTATGTGATTTGTTGG - Intergenic
1193160488 X:78223291-78223313 TTTTTGGTTTTTTGGTTTTTTGG - Intergenic
1193160489 X:78223299-78223321 GTTTTTGTTTTTTGGTTTTTTGG - Intergenic
1193204635 X:78734117-78734139 TTGTATGTTTTTTGGTTTGATGG + Intergenic
1193261123 X:79407312-79407334 TTTTTTTTTTTTTGGTTGATAGG - Intergenic
1193339307 X:80327940-80327962 TTTTATTTCTTGTGGTTTTTAGG + Intergenic
1193438569 X:81510898-81510920 TTTTTTGTTTTGTACTTTCTTGG + Intergenic
1193635633 X:83946074-83946096 TTTTTTGTTTTCTGTTTTCTTGG + Intergenic
1193765522 X:85524334-85524356 TTTTAGGTTTTCTAGTTTATTGG + Intergenic
1193905654 X:87240709-87240731 TTTTTTGTTTTGTTGAATATTGG + Intergenic
1194029413 X:88793192-88793214 TTTGGTATTTTGTGGTTTGTAGG - Intergenic
1194144870 X:90249454-90249476 TTTTATATTCTGTTGTTTTTAGG - Intergenic
1194159854 X:90436841-90436863 TTTTATGTGTTAAGGTTTAGGGG + Intergenic
1194485703 X:94483232-94483254 TTTTTTTTTTTTTGGTTTGTAGG + Intergenic
1194601629 X:95928253-95928275 TTTTTTGTTATGTGTTTTACTGG - Intergenic
1194991076 X:100547956-100547978 TTCTATATTTTGCAGTTTATTGG - Intergenic
1195142452 X:101976376-101976398 TTTTTTGTTTTCTGTTTTCTTGG + Intergenic
1195238345 X:102925085-102925107 TTTTAATTTTTGTGGGTGATAGG + Intergenic
1195281281 X:103336389-103336411 TTTTAAGTTTTTTTCTTTATTGG - Intergenic
1195997697 X:110747370-110747392 TTTTTTGGTTTTTGGTTTTTGGG - Intronic
1196061874 X:111417235-111417257 TTTTCTGTTTTGTGGATATTGGG - Intergenic
1196154367 X:112411087-112411109 TATTCTGTTTTCTAGTTTATTGG - Intergenic
1196340576 X:114591114-114591136 TTTAATGCTTTGTGGCTTGTGGG + Intronic
1196514967 X:116599332-116599354 TTATATGTTTTTTGGATTCTGGG + Intergenic
1196605453 X:117652444-117652466 TTTTATGGTTTATGCTTTTTGGG - Intergenic
1196896346 X:120340633-120340655 TGTTTTGTTTTGTTGTTTAATGG + Intergenic
1197325346 X:125086392-125086414 TTTTCTGTTTAGTTGATTATAGG - Intergenic
1197336546 X:125216075-125216097 TTTTATGTTTTGTGGATACAAGG - Intergenic
1198264243 X:134994682-134994704 TTTTTTGTTTTTTTGTTTTTTGG - Intergenic
1198498540 X:137219085-137219107 TTTTAGGTGGTTTGGTTTATGGG + Intergenic
1198584150 X:138100860-138100882 TTTTGTTTTTTGTGTTTTTTTGG - Intergenic
1198886152 X:141340183-141340205 TTTTTTTTTTAGTGATTTATAGG - Intergenic
1199040872 X:143113907-143113929 TTTTTTGTTTTCTAGTTTTTTGG + Intergenic
1199128994 X:144161836-144161858 TATTATATTTTGTTGTTTTTGGG - Intergenic
1199137411 X:144269209-144269231 TTTTATATTTTTTGGTTGGTAGG - Intergenic
1199195237 X:145021176-145021198 TTTTAGATTTTCTGATTTATTGG - Intergenic
1199269853 X:145870794-145870816 TTTTTTGTTTTCTGTTTTCTTGG + Intergenic
1199818630 X:151422882-151422904 TTTTTTGTTTTTTGTTTTTTTGG - Intergenic
1199887103 X:152031082-152031104 TATTATGTCTTGTGGTCTCTTGG + Intergenic
1200241489 X:154497073-154497095 TTTTCTGTTCTGTGGTCTTTTGG + Intergenic
1200484615 Y:3752201-3752223 ATTTATGGTTTATGGTTTATAGG - Intergenic
1200490627 Y:3818758-3818780 TTTTATATTCTGTTGTTTTTAGG - Intergenic
1200506150 Y:4013794-4013816 TTTTATGTGTTAAGGTTTAGGGG + Intergenic
1200709006 Y:6467158-6467180 TTTTTTTTTTTTTGGTTTATTGG - Intergenic
1200740042 Y:6844635-6844657 TTTTATCTTTGTTGGTTTAAAGG + Intergenic
1201025106 Y:9697551-9697573 TTTTTTTTTTTTTGGTTTATTGG + Intergenic
1201367988 Y:13229379-13229401 TTCTATGTTATTTAGTTTATTGG + Intergenic
1201510534 Y:14756082-14756104 TTCGATGTTTTGTGTTTTTTAGG + Intronic
1201893535 Y:18969447-18969469 TTTTATTTTCTGTGTATTATGGG - Intergenic
1201924597 Y:19270783-19270805 TTTCATGTGTTTTTGTTTATTGG - Intergenic
1201956714 Y:19632694-19632716 TTTTTTGTTTTCTGTTTTCTTGG + Intergenic
1202378089 Y:24256045-24256067 TTTTTTGTTTTTTGTTTTTTGGG + Intergenic
1202492693 Y:25414076-25414098 TTTTTTGTTTTTTGTTTTTTGGG - Intergenic