ID: 1007911598

View in Genome Browser
Species Human (GRCh38)
Location 6:45520573-45520595
Sequence TGCCCCCCAGTGCAAAGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 174}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007911598_1007911602 0 Left 1007911598 6:45520573-45520595 CCATTTCTTTGCACTGGGGGGCA 0: 1
1: 0
2: 1
3: 15
4: 174
Right 1007911602 6:45520596-45520618 GGGCCCTGTTGTTCCCTCTTGGG No data
1007911598_1007911601 -1 Left 1007911598 6:45520573-45520595 CCATTTCTTTGCACTGGGGGGCA 0: 1
1: 0
2: 1
3: 15
4: 174
Right 1007911601 6:45520595-45520617 AGGGCCCTGTTGTTCCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007911598 Original CRISPR TGCCCCCCAGTGCAAAGAAA TGG (reversed) Intronic
901123478 1:6913205-6913227 TGGCCGCCAGAGCAAAGACAGGG - Intronic
902054054 1:13585498-13585520 TGCTCACCAGGGCAAAGCAAGGG + Intronic
903875564 1:26471394-26471416 TGCCCCCTAGTCCAAAGCCAGGG - Intergenic
905469361 1:38180219-38180241 GGCCCCCAAGTGAAGAGAAAGGG - Intergenic
905690810 1:39941297-39941319 TTCCCCACAGGGCAAACAAAGGG + Intergenic
906414193 1:45607163-45607185 TGCCCCCTAGAGAAAAGGAAAGG - Intronic
907117132 1:51978792-51978814 TTTCCCCAAGGGCAAAGAAAGGG + Intronic
913585604 1:120272419-120272441 TGCCCACCAGGCCAAAGCAAAGG - Intergenic
913622580 1:120625948-120625970 TGCCCACCAGGCCAAAGCAAAGG + Intergenic
914567610 1:148884278-148884300 TGCCCACCAGGCCAAAGCAAAGG - Intronic
914605212 1:149245967-149245989 TGCCCACCAGGCCAAAGCAAAGG + Intergenic
919660776 1:200243334-200243356 CGCCCTGCAGAGCAAAGAAAGGG + Intergenic
919902602 1:202055326-202055348 TGCACGCCAGAGCAAAGAGATGG + Intergenic
920176029 1:204102508-204102530 TGCCCCACAGTGCAAACAGGCGG - Intronic
920274234 1:204792155-204792177 ACACCCCCAGGGCAAAGAAAGGG + Intergenic
920513316 1:206566552-206566574 TGCTCCCCACTGCAAAGCGAGGG - Intronic
1065897360 10:30175848-30175870 TGCAACTCAGAGCAAAGAAAGGG - Intergenic
1068097905 10:52515135-52515157 AGCCCCCCACTGCATAGCAAAGG - Intergenic
1071180576 10:82978966-82978988 TGCAGCCCAGGGCAAAGAAGTGG + Exonic
1071244590 10:83749508-83749530 TGCTCCCTAGTGCAAGGAAAAGG + Intergenic
1075204051 10:120431379-120431401 TGCCCAGCACTGCCAAGAAATGG + Intergenic
1077020428 11:414829-414851 TGCCCCCCGGAGGAAAGAACTGG - Exonic
1078951542 11:16140383-16140405 TGCCTCCCAGTTAAATGAAAGGG - Intronic
1081988560 11:47325159-47325181 TGCTCCCCAATCAAAAGAAAGGG - Intronic
1082132904 11:48512858-48512880 TGCACCCCAGTTCCAATAAAGGG - Intergenic
1082716532 11:56620607-56620629 TGATCACCAGTGCAATGAAAAGG + Intergenic
1083724051 11:64619192-64619214 TGCCACCCATTGCAAGGTAATGG + Intronic
1085271775 11:75273984-75274006 GTCCCCCCAGTTCAAAGACAAGG - Intronic
1085277871 11:75311708-75311730 TGAGCCCCAGGGCAAACAAACGG + Intronic
1085779636 11:79396574-79396596 TCCACCCCAGGGCAAGGAAATGG + Intronic
1085979836 11:81711135-81711157 TTGCCTCCAGTGCAAATAAATGG - Intergenic
1091016180 11:132052699-132052721 TGCCCCCTAGAAAAAAGAAAGGG - Intronic
1098057008 12:66517969-66517991 TGCTCCCCCTAGCAAAGAAAAGG + Exonic
1100054629 12:90493760-90493782 TGCCCTCCAGAAAAAAGAAAAGG - Intergenic
1100719033 12:97337361-97337383 TGTCCCCCACTGAAAACAAATGG - Intergenic
1100778577 12:97999599-97999621 TGCCACCCTGTGGAAACAAAAGG + Intergenic
1101651345 12:106680257-106680279 AGCTCCCCAGTGTAGAGAAATGG + Intronic
1102677672 12:114669212-114669234 TGGCCCCCAGGGCAAGAAAAGGG + Intergenic
1102964954 12:117118803-117118825 TGCCCCCCACTGCTGGGAAAGGG + Intergenic
1104662239 12:130619758-130619780 AGCTCCCCGGTGCAAACAAAAGG - Intronic
1106549705 13:30760603-30760625 TGCCCTGCAGTGCAAAGCACGGG + Intronic
1106663046 13:31822575-31822597 AGCCCCACAGTGCCAAGAAAAGG + Intergenic
1108927932 13:55776995-55777017 AGCTCCCCAGTGCGAGGAAAGGG + Intergenic
1109155794 13:58907051-58907073 AGCTCCCCAGTGCCAGGAAAGGG - Intergenic
1109745570 13:66618896-66618918 TGCCTCCTAGTGTAAAGTAAGGG - Intronic
1110394194 13:75011085-75011107 TGCTCCACAGAGTAAAGAAAAGG - Intergenic
1116353281 14:43894729-43894751 TGCCCCCTAGCGGTAAGAAAGGG + Intergenic
1118221696 14:63860317-63860339 TGCAGCCCAGAGGAAAGAAAAGG - Intronic
1118423242 14:65631616-65631638 TTCCCCCCATTGGAAGGAAAAGG + Intronic
1119744006 14:77031666-77031688 GGCCCCTGAGTGCAAAGGAAAGG + Intergenic
1120246131 14:82009202-82009224 TGCCCCCTAGGGGAAAAAAATGG - Intergenic
1122042664 14:99000064-99000086 TGGTCCCCAGTGCAAAGGCAGGG - Intergenic
1123000433 14:105291143-105291165 TGCCCCCCTGTGTACAGCAAGGG + Intronic
1123488636 15:20763017-20763039 GGCCCCCCACAGCAAGGAAAGGG + Intergenic
1123545132 15:21332090-21332112 GGCCCCCCACAGCAAGGAAAGGG + Intergenic
1124126120 15:26939346-26939368 TGCCCCCGATTTCAAAGAACAGG + Intronic
1127483174 15:59395874-59395896 TTCCCCCAAATCCAAAGAAAGGG + Intronic
1128508967 15:68302013-68302035 TGCCCGCCAGTGCACAGGGAAGG - Exonic
1130022276 15:80241581-80241603 TGCCCTGCAGAGCAAAGCAAAGG - Intergenic
1202953478 15_KI270727v1_random:59361-59383 GGCCCCCCACAGCAAGGAAAGGG + Intergenic
1135469065 16:22712926-22712948 TGCCACCCAGATCAAAGAAATGG - Intergenic
1135628733 16:24018962-24018984 TGCCCACAACTGCAAACAAAAGG - Intronic
1137022149 16:35439587-35439609 TGTCCCCCCAGGCAAAGAAAAGG - Intergenic
1140127537 16:72130693-72130715 AGCAGCCCAGTGCAAAGAAGAGG - Exonic
1144740741 17:17580847-17580869 TGCTCCCCAGGGCACAGCAAAGG + Intronic
1146844694 17:36175298-36175320 TGTCCCCCAATGCCATGAAATGG + Intronic
1146857000 17:36263233-36263255 TGTCCCCCAATGCCATGAAATGG + Intronic
1146863617 17:36325142-36325164 TGTCCCCCAATGCCATGAAATGG - Intronic
1146872910 17:36387143-36387165 TGTCCCCCAATGCCATGAAATGG + Intronic
1146880268 17:36438229-36438251 TGTCCCCCAATGCCATGAAATGG + Intronic
1147066477 17:37925730-37925752 TGTCCCCCAATGCCATGAAATGG - Intronic
1147075794 17:37987768-37987790 TGTCCCCCAATGCCATGAAATGG + Intronic
1147078009 17:38005291-38005313 TGTCCCCCAATGCCATGAAATGG - Intronic
1147087319 17:38067314-38067336 TGTCCCCCAATGCCATGAAATGG + Intronic
1147093945 17:38129226-38129248 TGTCCCCCAATGCCATGAAATGG - Intergenic
1147103264 17:38191277-38191299 TGTCCCCCAATGCCATGAAATGG + Intergenic
1147984332 17:44296305-44296327 TGGCCCCCACTTCAATGAAAGGG + Intergenic
1149019827 17:51950336-51950358 AGCCTCCCAGGGCACAGAAAAGG - Intronic
1149847838 17:60017746-60017768 TGTCCCCCAGTGCCATGAAATGG + Intergenic
1150086194 17:62274363-62274385 TGTCCCCCAGTGCCATGAAATGG + Intronic
1150612139 17:66741987-66742009 TGACCTCCATTCCAAAGAAAAGG - Intronic
1151746017 17:76012185-76012207 TGCCTCCCAGGGACAAGAAAGGG + Intronic
1155128344 18:22903014-22903036 TGCCACTCAGTGGGAAGAAAGGG - Intronic
1157612053 18:48963382-48963404 TACCTCCCAGTGCAAAGAGAGGG + Intergenic
1157722259 18:49934358-49934380 TTCCTCCCAATACAAAGAAAAGG - Intronic
1157750336 18:50172872-50172894 AGCCCCCCAGTGCAAAGACTGGG + Intronic
1158748327 18:60227391-60227413 GGTTCCCCAGTGCAAGGAAAGGG - Intergenic
1161171786 19:2815758-2815780 TGCTCCCCAGTGGAAAAAAAAGG + Exonic
1161855049 19:6759658-6759680 TGTCCCCCAGGGCAAGGAAGTGG - Exonic
1162751529 19:12832894-12832916 TGTCCCCCAGTGCCAAGACTGGG + Intronic
1164622080 19:29702450-29702472 GGCCCCCCAGTGAAGAGTAAAGG - Exonic
1166435649 19:42764804-42764826 TGCACCCCAGTGCCCAGAACAGG + Intronic
1168143067 19:54402489-54402511 TGCCCCGCAGTGAAAATGAACGG - Intergenic
925043151 2:749516-749538 TTCCCCCCAGTGCGAGGACAGGG - Intergenic
926348766 2:11975687-11975709 AGCTCCCCAATGCAAGGAAAAGG - Intergenic
926744048 2:16136026-16136048 TACACCCCAGTGCATAGGAAGGG - Intergenic
927066828 2:19480223-19480245 TGCCCCTCAGTGCAATGAACTGG + Intergenic
929081257 2:38124711-38124733 TGGCCCCAAGTTCAAAGATATGG + Intergenic
939280298 2:140055409-140055431 TGCCCACCATTTCAAACAAAGGG - Intergenic
939367335 2:141250349-141250371 TGACCTCCAGTGAGAAGAAAGGG + Intronic
943346714 2:186746846-186746868 TTCCCCAGAGTGGAAAGAAAAGG + Intronic
944845379 2:203662799-203662821 TGCCCCCCTGTACACAGGAATGG - Intergenic
945347274 2:208732805-208732827 TATTCCCCAGTGGAAAGAAAAGG + Intronic
947764016 2:232624308-232624330 TGCCCCCCAGACCACAGACATGG + Intronic
947939217 2:234035090-234035112 GGCTCCCCAGTCTAAAGAAAGGG + Intergenic
948810779 2:240476643-240476665 TGCCCACCAGGGAAAAGAAATGG + Intergenic
1170481276 20:16767487-16767509 GCCCACCCAGTGCCAAGAAAAGG - Intronic
1170896504 20:20419863-20419885 TGCCCCCCTGTGCTAGGTAATGG + Intronic
1173663136 20:44747676-44747698 TGCCCCCAAGTGGCCAGAAAAGG - Intronic
1174071709 20:47904440-47904462 TCCCCACAAGTGCAAAGAACAGG - Intergenic
1174159924 20:48543372-48543394 AGTCCACCAGTGCTAAGAAATGG + Intergenic
1178626448 21:34222739-34222761 TGACTCTCAGTGCAAAGACAGGG + Intergenic
1179232241 21:39514936-39514958 TGCTCCCCACTGAAAGGAAAGGG - Intronic
1180128236 21:45806312-45806334 TACCCCTCACTGCACAGAAAGGG + Intronic
1182106037 22:27690249-27690271 TCTCCCCCATTTCAAAGAAATGG - Intergenic
1184171919 22:42765039-42765061 TCCCCCCCAGTCCACAGGAAAGG + Intergenic
1184300602 22:43556516-43556538 TGCCCCTCAGTGCCATGCAAAGG + Intronic
1184737632 22:46408814-46408836 CGCCTCCCAGAGGAAAGAAAGGG + Intronic
957543799 3:81610725-81610747 TGCCCCCCATTGAAGAGGAAAGG - Intronic
958590404 3:96151469-96151491 TGTCCCCCAGTTCAAACATATGG + Intergenic
959950521 3:112175404-112175426 TCCCACCCAGTGAAAAGGAATGG + Intronic
960734823 3:120767410-120767432 CACCCTCCAGTGCAAAGAATGGG + Intronic
962208161 3:133452711-133452733 TGCAGCCCAATGCAGAGAAAAGG - Intronic
963003349 3:140703839-140703861 TGCACCCCATTGGTAAGAAAGGG - Intergenic
966110349 3:176393604-176393626 TGCCCTCAAGTGCAAAGAAATGG - Intergenic
967361335 3:188635358-188635380 TGCCCCACAGTTCAAAGGAAAGG - Intronic
968946654 4:3668532-3668554 TGCCACCCAGAGCAGACAAAGGG - Intergenic
969498106 4:7537592-7537614 TGCTCCCCAGTGCCCAGCAAGGG - Intronic
971019419 4:22518428-22518450 TACACCACAGAGCAAAGAAAAGG - Intergenic
971955951 4:33418637-33418659 AACTCCTCAGTGCAAAGAAAGGG + Intergenic
972994151 4:44859160-44859182 CGCAGCCCAGTGCAAAAAAACGG - Intergenic
977301761 4:95275251-95275273 TACCCCACAGTGCCAAGAAGAGG + Intronic
979195488 4:117916051-117916073 TTCCCACCAGTGCAAAGATCTGG + Intergenic
981010822 4:139922992-139923014 TGCACCCCAGTGCTCAGAAGGGG + Intronic
982397220 4:154925612-154925634 TGCCTCCCAGTGAGAAGGAATGG + Intergenic
982581697 4:157187507-157187529 GGCTCCCCAGTGCAGGGAAAGGG + Intergenic
984958375 4:185069078-185069100 TGGCTCCCAGTGCAGAGAAAGGG + Intergenic
986409529 5:7463432-7463454 TTCCCTCAAGTGCAAAGGAAGGG - Intronic
993018411 5:82563140-82563162 TTCCACCCAGTGAATAGAAATGG - Intergenic
999430756 5:151523543-151523565 TGCCTCCCAGTGCATGGAAGTGG + Intronic
999935916 5:156485873-156485895 AACTCCCCAGTGCAGAGAAAAGG + Intronic
1000181983 5:158820579-158820601 TTCTCTCCAGTGGAAAGAAAGGG - Intronic
1001380785 5:171305087-171305109 TGCCAGCCAGTGGAAGGAAAAGG - Intergenic
1002024101 5:176385114-176385136 TGAAACCGAGTGCAAAGAAAGGG - Intronic
1003156844 6:3603910-3603932 GGCCTCCTAGTGCACAGAAAGGG - Intergenic
1004420413 6:15464576-15464598 TACCCCCCAGTGAGAAGAAGGGG + Intronic
1007354641 6:41304976-41304998 TGCAAGGCAGTGCAAAGAAATGG - Intergenic
1007911598 6:45520573-45520595 TGCCCCCCAGTGCAAAGAAATGG - Intronic
1008173069 6:48233765-48233787 TTCCCCCCGGTGAAAAGGAACGG - Intergenic
1011547545 6:88498118-88498140 TGCTCTCCAGTCCAAAGACATGG + Intergenic
1012358337 6:98344838-98344860 TGGCTCCCAGAACAAAGAAAGGG + Intergenic
1013152898 6:107463146-107463168 TTCACCTCAGTGTAAAGAAATGG - Intergenic
1016178576 6:141113246-141113268 TGCTCACTAGTGGAAAGAAATGG + Intergenic
1021402834 7:20229312-20229334 TACCCACCAGTGAAAATAAAAGG - Intergenic
1025018884 7:55464988-55465010 AACCCCCCAGTGCAGAGAGAAGG - Intronic
1026143217 7:67723763-67723785 TGGCCCCCAGTGGAAGGTAATGG - Intergenic
1028741134 7:94277168-94277190 TGCCTACCAGTGCAGAGGAAAGG - Intergenic
1029126248 7:98296961-98296983 TGTCCCCCACTGCAAGGAAAGGG - Intronic
1030605423 7:111634081-111634103 GGCTCCTCAGTGCAAGGAAAGGG - Intergenic
1030720886 7:112868971-112868993 AGCCCACCAGTCCAAAGACAGGG + Intronic
1031508770 7:122622701-122622723 TGACCACCAGTGCACAGAACCGG + Intronic
1032775599 7:135109698-135109720 TTCCTCCCAGTGAAGAGAAATGG + Intronic
1033842144 7:145387261-145387283 GGCTCCCCAGTGCAAGGAGAGGG - Intergenic
1034396666 7:150831235-150831257 TGCCCCCCAGGGCACAGCCAGGG + Intronic
1039102671 8:33957796-33957818 TCCCACCCAGTGAAGAGAAATGG + Intergenic
1039203548 8:35123623-35123645 GCCACCCCAGTGGAAAGAAAGGG - Intergenic
1047777324 8:128083758-128083780 TGACCCTCACTGCATAGAAAGGG - Intergenic
1051692046 9:19725219-19725241 TTCCCCCCACAACAAAGAAATGG + Intronic
1055604724 9:77956784-77956806 AGCCCCGCAGTGCACAGGAAGGG - Intronic
1057851360 9:98569078-98569100 TGGAGACCAGTGCAAAGAAATGG + Intronic
1059126487 9:111691923-111691945 TGCCCTCTAGTGAAAAGATAGGG + Exonic
1060103979 9:120862257-120862279 TGCCCCCCAGTGCCAGGATGAGG + Intronic
1062094174 9:134694531-134694553 TGCCCCCAAGTGCAGAAAATGGG - Intronic
1188722677 X:33543080-33543102 GGCTCCCCAGTGCGAGGAAAGGG + Intergenic
1188729538 X:33630346-33630368 TGCTCCCCAGTGCAAGAAAAGGG + Intergenic
1189219232 X:39357125-39357147 AGGCCCCCAGGGCAAAGAGAGGG + Intergenic
1189274798 X:39777967-39777989 TGCCACTCAGTGCAGAGAATGGG + Intergenic
1189288167 X:39866710-39866732 TGCCCCCAAGAGCTAAGGAAGGG + Intergenic
1190130868 X:47747788-47747810 TGCCCCTCAGTGCATAGCAATGG - Intergenic
1191684732 X:63878630-63878652 GGCTTCCCAATGCAAAGAAAAGG + Intergenic
1191743877 X:64464891-64464913 TCCCACCCAGTGAGAAGAAACGG + Intergenic
1192502053 X:71660827-71660849 TGCCCCCCAGGGCAGTGATAGGG + Intergenic
1192789978 X:74371968-74371990 TGTCAGCCAGTGGAAAGAAATGG - Intergenic
1193015895 X:76733516-76733538 TTCCACCCAGTGAAGAGAAATGG + Intergenic
1194585880 X:95733792-95733814 TGTTCCACAGTGCAAAGAGATGG - Intergenic
1198854914 X:141005604-141005626 TGCCACCAAGGGCTAAGAAACGG + Intergenic
1198877098 X:141239539-141239561 TGCCACCAAGGGCTAAGAAACGG - Intergenic
1198907778 X:141581765-141581787 TGCCACCAAGGGCTAAGAAACGG - Intergenic
1198909013 X:141592659-141592681 TGCCACCAAGGGCTAAGAAACGG + Intronic
1198918067 X:141695493-141695515 TGCCACCAAGGGCTAAGAAACGG - Intronic
1200168199 X:154051878-154051900 TGGCCCTCAGGGCAAAGCAAGGG + Intronic