ID: 1007918019

View in Genome Browser
Species Human (GRCh38)
Location 6:45579262-45579284
Sequence CCTCATCTGTAAAATGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2830
Summary {0: 15, 1: 99, 2: 349, 3: 811, 4: 1556}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007918019_1007918024 -4 Left 1007918019 6:45579262-45579284 CCATCCCCATTTTACAGATGAGG 0: 15
1: 99
2: 349
3: 811
4: 1556
Right 1007918024 6:45579281-45579303 GAGGAAACTAAATCTCAGAGAGG 0: 3
1: 19
2: 207
3: 1357
4: 4629
1007918019_1007918025 14 Left 1007918019 6:45579262-45579284 CCATCCCCATTTTACAGATGAGG 0: 15
1: 99
2: 349
3: 811
4: 1556
Right 1007918025 6:45579299-45579321 AGAGGCTAAGTGACTTACGTAGG No data
1007918019_1007918026 26 Left 1007918019 6:45579262-45579284 CCATCCCCATTTTACAGATGAGG 0: 15
1: 99
2: 349
3: 811
4: 1556
Right 1007918026 6:45579311-45579333 ACTTACGTAGGCCACACAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007918019 Original CRISPR CCTCATCTGTAAAATGGGGA TGG (reversed) Intronic
Too many off-targets to display for this crispr