ID: 1007919954

View in Genome Browser
Species Human (GRCh38)
Location 6:45598021-45598043
Sequence GAGCCACTCCTTCTTCCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 177}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007919950_1007919954 4 Left 1007919950 6:45597994-45598016 CCCCGGATGTAAATTGATGTTAT 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1007919954 6:45598021-45598043 GAGCCACTCCTTCTTCCAAAGGG 0: 1
1: 0
2: 1
3: 15
4: 177
1007919951_1007919954 3 Left 1007919951 6:45597995-45598017 CCCGGATGTAAATTGATGTTATC 0: 1
1: 0
2: 1
3: 8
4: 116
Right 1007919954 6:45598021-45598043 GAGCCACTCCTTCTTCCAAAGGG 0: 1
1: 0
2: 1
3: 15
4: 177
1007919949_1007919954 19 Left 1007919949 6:45597979-45598001 CCATAAATCAAATTTCCCCGGAT 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1007919954 6:45598021-45598043 GAGCCACTCCTTCTTCCAAAGGG 0: 1
1: 0
2: 1
3: 15
4: 177
1007919952_1007919954 2 Left 1007919952 6:45597996-45598018 CCGGATGTAAATTGATGTTATCT 0: 1
1: 0
2: 0
3: 10
4: 248
Right 1007919954 6:45598021-45598043 GAGCCACTCCTTCTTCCAAAGGG 0: 1
1: 0
2: 1
3: 15
4: 177
1007919947_1007919954 29 Left 1007919947 6:45597969-45597991 CCTTTCTTGTCCATAAATCAAAT 0: 1
1: 0
2: 3
3: 24
4: 271
Right 1007919954 6:45598021-45598043 GAGCCACTCCTTCTTCCAAAGGG 0: 1
1: 0
2: 1
3: 15
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007919954 Original CRISPR GAGCCACTCCTTCTTCCAAA GGG Intronic
900140007 1:1135846-1135868 GAGCAACTCCATCTTGCACAGGG - Intergenic
901081832 1:6588090-6588112 CAGCCACGCCTTCACCCAAAAGG + Exonic
901131266 1:6963368-6963390 GAGCCACCCCTCTTTCCAATCGG + Intronic
902492980 1:16798844-16798866 GAGCCAGTATTTCTTCCCAAAGG + Intronic
903189461 1:21648719-21648741 GAGCCCCTCCTTCTGCAAGATGG - Intronic
904576460 1:31508088-31508110 GAGCCATTCCTTCTTCCTGGTGG + Intergenic
908623077 1:66007563-66007585 GTTCCACTTCTTTTTCCAAATGG + Intronic
909709147 1:78624333-78624355 GATCCACTGCTTATTCCAGAGGG + Intronic
911456171 1:98126304-98126326 AAGACACTCCTTCTTCCAACTGG - Intergenic
912793120 1:112673139-112673161 GAGCAACTCCATCTTCAACAGGG - Intronic
918359526 1:183741735-183741757 TAGCCAGTGCTTCTTCCACATGG + Intronic
920563473 1:206955920-206955942 GGACCTCTCCTTCCTCCAAACGG - Intergenic
921010590 1:211136934-211136956 AAGCCACTCCTTCATTTAAAGGG + Intergenic
1064306866 10:14175329-14175351 GAGCCACTCTGTCCTCCAGATGG + Intronic
1064763218 10:18643586-18643608 GAACTTCTGCTTCTTCCAAAGGG + Intronic
1064891070 10:20174511-20174533 GAGCCACTCCTAGCCCCAAAAGG + Intronic
1067125145 10:43509560-43509582 GAACCAGTCCAACTTCCAAAAGG + Intergenic
1070770699 10:79080766-79080788 GACCCACTCCTTCTGCCTAAAGG - Intronic
1073437385 10:103527725-103527747 GAGCCACTCCATCTTCAACAGGG - Intronic
1074114342 10:110444287-110444309 CAGCCCCTCCTCCTTCCAAAAGG + Intergenic
1074306530 10:112284268-112284290 GATACATTCCTTGTTCCAAATGG + Intronic
1083483414 11:62965146-62965168 AACCCACTCCTTATTCCATAAGG - Intronic
1084684311 11:70684865-70684887 GAGTCCCTTCTTCTTCCTAAAGG - Intronic
1090455818 11:126848993-126849015 GAGCCACTCCATCTTGAATAGGG + Intronic
1090882056 11:130842363-130842385 TAGTCACTCTTTCTTCCAAGTGG - Intergenic
1091483469 12:859266-859288 GAACCATGCCTTCTTCCAAGAGG + Exonic
1093460715 12:19404465-19404487 TACCCACTGCTTCTTTCAAAGGG + Intronic
1094372616 12:29754298-29754320 GAGCCAGGCCTTTTTCAAAAGGG - Intronic
1094594457 12:31852034-31852056 GAGCAACTCCATCTTGAAAAGGG + Intergenic
1097889342 12:64761361-64761383 GAGCAACTCCATCTTGAAAAGGG + Intergenic
1098569523 12:71973166-71973188 GAGCAACTCCTTCTTGAATAGGG + Intronic
1102941874 12:116949829-116949851 GAGACTCTCCCTCTTCCACATGG - Intronic
1103518135 12:121520719-121520741 GAGACACTTCCTCTTCCACAAGG + Intronic
1108151862 13:47544347-47544369 AAGCCTATCTTTCTTCCAAAAGG - Intergenic
1110156459 13:72322608-72322630 GTCCCACTCCCTCTTCCAACAGG + Intergenic
1110699886 13:78534792-78534814 GAGTCATTCCTTCTTTCAACAGG - Intergenic
1111667189 13:91284337-91284359 GAGCCACTCCATCTAACACAGGG - Intergenic
1113108346 13:106795700-106795722 GAGCAACTCCATCTTGCACAGGG + Intergenic
1117044711 14:51801615-51801637 AAGCCCAACCTTCTTCCAAAAGG - Intergenic
1118475150 14:66109596-66109618 GAACCACTCCTACTTCCACCAGG - Intergenic
1119982215 14:79094426-79094448 AATCCACTCATTCTTACAAAGGG - Intronic
1121619190 14:95334377-95334399 GAGCCAGTCCATTTTCCACATGG - Intergenic
1122677496 14:103427993-103428015 GAGCAACTCCATCTTGAAAAGGG - Intronic
1124905812 15:33867606-33867628 GATCTAGTTCTTCTTCCAAATGG + Exonic
1125403308 15:39327439-39327461 AACCCACCCCTTCGTCCAAAAGG + Intergenic
1127163619 15:56219294-56219316 GAGCCACTCCAGCTTTCTAATGG + Intronic
1128807785 15:70545608-70545630 GGGTCACACCTTCTTCCAAGAGG - Intergenic
1128991841 15:72267358-72267380 TAGCCACTCTATCTTCCAAAAGG + Intronic
1130914472 15:88294027-88294049 GAGCCAGTTCTTCTACCATAGGG + Intergenic
1133561857 16:6957730-6957752 GAGCAACTCCATCTTCAATAGGG - Intronic
1133569263 16:7025501-7025523 GAGCAACTCCATCTTCCATAGGG - Intronic
1136656245 16:31711013-31711035 CAGCCTCTCCATCTTCCAACAGG + Intergenic
1138890797 16:61142095-61142117 AAGAGACTCCTTCTTTCAAATGG - Intergenic
1140253401 16:73314683-73314705 GAGCTGCTCCTCCTACCAAATGG + Intergenic
1146118187 17:30162571-30162593 GAACCAATCCTTCTTTCAAATGG - Intronic
1147610084 17:41796672-41796694 GGGCCACTCTTTGTTCCCAAGGG + Intergenic
1149691412 17:58580114-58580136 CAGTCACTGCCTCTTCCAAAAGG - Intronic
1150125916 17:62634784-62634806 GAGCAACTCCATCTTTAAAAGGG - Intronic
1155753932 18:29466003-29466025 GAACCCCTCCTTGTCCCAAAGGG + Intergenic
1155943749 18:31825384-31825406 GAGTGACCCCTTCTGCCAAAAGG + Intergenic
1158109686 18:53927519-53927541 AAGCAACTTCTTCTTCCCAAAGG - Intergenic
1159189740 18:65026144-65026166 CAGCCACTCCTTCATTCACAGGG + Intergenic
1159366844 18:67477158-67477180 GTGACACTCCTTCCTCCATATGG - Intergenic
1159391991 18:67805524-67805546 GAGCCACTATTTCCTGCAAAAGG + Intergenic
1159452149 18:68616246-68616268 GAGCCACATCTTCATTCAAATGG + Intergenic
1160528098 18:79548898-79548920 GAGCCGCTCTTGCTTCCAACAGG - Intergenic
1160938487 19:1609072-1609094 GAGCCAATCCTGCTTCCAGGTGG + Intergenic
1162570124 19:11466742-11466764 GGGCCACTCCTTGGTACAAATGG - Exonic
1167881642 19:52463850-52463872 TAGTCACAGCTTCTTCCAAAGGG + Intronic
925344434 2:3160593-3160615 TAGCCTCTCTTTCCTCCAAAGGG + Intergenic
925377043 2:3394136-3394158 CAGCCTCTCCCTCTTCCAGATGG - Intronic
927847306 2:26478155-26478177 GAGCCACTCCCTCTTCCCCCAGG - Intronic
928689219 2:33781913-33781935 TTGCCAATCCTTCTTCCATAAGG + Intergenic
930036303 2:47087425-47087447 AAGGCACACCTTCTCCCAAAGGG + Intronic
932796321 2:74699194-74699216 GAGCTACTCTGACTTCCAAAGGG + Intergenic
938880788 2:135584965-135584987 GAGCTACTGCTTTTGCCAAAGGG - Intronic
939412750 2:141851820-141851842 AAGCCACTTTTTCTTGCAAATGG + Intronic
943225388 2:185167305-185167327 GAGCCATGTCTGCTTCCAAAAGG - Intergenic
943226924 2:185189328-185189350 AAGCCACTCTATCTTACAAATGG - Intergenic
943353382 2:186821743-186821765 GGGCCACCCCTTCTTCATAAGGG + Intergenic
945034946 2:205696679-205696701 GAGCCAGCCCTTCCTGCAAACGG + Intronic
946462172 2:219878445-219878467 GAGCAACTCCATCTTGAAAAGGG + Intergenic
948810201 2:240471127-240471149 CAGCCACTGATTCTTCAAAAAGG - Intergenic
1168892013 20:1300787-1300809 CAGCCACTCCTCCCTCCAAGAGG - Intronic
1170820012 20:19749532-19749554 GAGCGACTCCATCTTGAAAACGG + Intergenic
1172649454 20:36492578-36492600 GAGGCACACCTTCTTCCCAATGG - Intronic
1173582237 20:44155442-44155464 GATTTGCTCCTTCTTCCAAAGGG - Intronic
1173854810 20:46243283-46243305 GGGCCATTCAATCTTCCAAATGG - Intronic
1179943271 21:44653561-44653583 TAGCTACTCCTTCATCCAACTGG - Intronic
1181235539 22:21445893-21445915 GCCCCACTCCTTCTTCCGAGTGG - Exonic
1182784918 22:32899400-32899422 GTCCCACTCCTGCTTACAAAAGG - Intronic
949394743 3:3602758-3602780 CTGCCACTCCTTCCTCCACAGGG - Intergenic
949661641 3:6285550-6285572 TAGCCATTCCTTCTCCAAAAAGG - Intergenic
950579367 3:13852506-13852528 GACCCACTCCTTGTTCCGACCGG - Intronic
952295285 3:32056759-32056781 GAGCAACTCCATCTTGAAAAGGG + Intronic
952350437 3:32531114-32531136 GAGCCAGTGATTCTTCTAAAAGG + Intronic
952815257 3:37442053-37442075 TTGACACTCCTTCCTCCAAAAGG - Intergenic
953131590 3:40144466-40144488 GTGCCCCTCATTCTTCTAAAAGG - Intronic
953815608 3:46153847-46153869 GGGACACTCCTTCTTCCCAGAGG + Intergenic
954357855 3:50097645-50097667 GACCAACTCCTTTTTCCAAAAGG - Intronic
955431426 3:58849162-58849184 GACCCACACCTTCTTCCAGTTGG + Intronic
955656002 3:61245847-61245869 GAGCAACTCCATCTTCAATAGGG + Intronic
956116695 3:65926415-65926437 GAGCAACTCCATCTTGAAAAGGG + Intronic
957922482 3:86763268-86763290 AAGCCACTCCTTCCTGCAGAGGG - Intergenic
959872677 3:111346425-111346447 GAGCAACTCCATCTTCAATAGGG - Intronic
960719508 3:120611940-120611962 GAGCCACTCCATCTTAAATAGGG + Intergenic
961684315 3:128618769-128618791 GATCCACTCCTACAGCCAAAAGG + Intergenic
962095251 3:132286220-132286242 GAGCAACTCCATCTTGAAAAGGG + Intergenic
962907094 3:139813755-139813777 GAGCCACTCCATCTTGAATAAGG - Intergenic
963540799 3:146585020-146585042 TATTCTCTCCTTCTTCCAAATGG - Intronic
963983055 3:151561999-151562021 GAGCAACTCCATCTTGAAAAGGG + Intergenic
964771722 3:160230971-160230993 AAGCCATTCTTTCTTCCACATGG + Intronic
965855350 3:173081415-173081437 AAGCGACTCATTCTCCCAAATGG - Intronic
967648536 3:191956683-191956705 GAACCACTCCATTTTCCAGATGG + Intergenic
968926647 4:3551857-3551879 CAGCCAGTCCTTCTTCCCATGGG - Intergenic
971225956 4:24751789-24751811 CAGCCACTCCTTCCTCCAAAGGG + Intergenic
972922075 4:43956268-43956290 AAGCCATTCCTGCTTCCAAATGG - Intergenic
973330764 4:48908233-48908255 GAGCCACTCCATCTTGAATAGGG - Intergenic
977392654 4:96431543-96431565 TATCCACTGCTTTTTCCAAAGGG + Intergenic
977966355 4:103153834-103153856 GAGGCAGTCCTACTTACAAAAGG + Intronic
982164941 4:152605633-152605655 GAGCCACTCCATTTTCAAATGGG + Intergenic
982422672 4:155215173-155215195 GATCCACTTCTTCTTTAAAATGG - Exonic
984601198 4:181728814-181728836 GAGCGACTCCATCTTGAAAAGGG - Intergenic
985618776 5:941178-941200 TAGCCACATCATCTTCCAAATGG + Intergenic
986336075 5:6756534-6756556 GAGCCAGTCCTGCTTCAAAAGGG - Exonic
986569866 5:9153653-9153675 CAACCACTCCTTCTTCTCAAGGG + Intronic
988124092 5:27006488-27006510 GAGCCACAGCTTCTTTCAGATGG + Intronic
988295488 5:29354924-29354946 GAGCAACTCCATCTTGAAAAGGG + Intergenic
988732709 5:33989216-33989238 CAGCCATCCCTTCTTTCAAAAGG - Exonic
989528998 5:42484863-42484885 GAGGCAGTCCTTCTGCCAAGTGG + Intronic
990070497 5:51776993-51777015 GAGCCACTCCATCTTGAATAAGG - Intergenic
990598325 5:57332960-57332982 GAGCCACCCCTTCTGCCTAATGG + Intergenic
991363504 5:65844714-65844736 GAGCAACTCCATCTTGGAAAGGG - Intronic
992640648 5:78765900-78765922 GAGGCGTTCCTTCTTCCACAGGG - Intronic
993792864 5:92228737-92228759 GAGCCATTTCTTTTTCCTAAAGG - Intergenic
995345069 5:111104311-111104333 GAGCCACTTCTTGTCACAAATGG + Exonic
998630049 5:143888245-143888267 GAGCCATTTCTGCTTCCGAAGGG + Intergenic
1000310268 5:160036734-160036756 GTGCCCATCCTGCTTCCAAAAGG + Exonic
1000431539 5:161158404-161158426 TAGCCATTGCTTCTGCCAAATGG - Intergenic
1001089035 5:168723377-168723399 CACCCACTCATTCATCCAAATGG + Intronic
1006169788 6:32086248-32086270 GGGCCACTCCCTCCTCCCAAAGG + Intronic
1007919954 6:45598021-45598043 GAGCCACTCCTTCTTCCAAAGGG + Intronic
1009623223 6:66102270-66102292 GAGCCATTCCTCCTTACAAATGG + Intergenic
1009737187 6:67691120-67691142 AAGCCTCTCATTCATCCAAATGG + Intergenic
1011057724 6:83223878-83223900 GATCCAGTCACTCTTCCAAATGG - Exonic
1011705713 6:89999263-89999285 GAGCCAGTCCTTCTTAGAATAGG - Intronic
1013261418 6:108447168-108447190 GAGCCACTACTTGTTTAAAAAGG + Intronic
1017740999 6:157406596-157406618 AAGTCACTCCTTCTTCAAAATGG + Intronic
1018633818 6:165843373-165843395 AAGCCACTCCCTCTTCCTGAAGG - Intronic
1020698745 7:11449738-11449760 GGGTCAATCCTGCTTCCAAATGG - Intronic
1021165415 7:17333672-17333694 GAACCACTCCTTGTTCCTAATGG - Intronic
1022379101 7:29843229-29843251 CTGCCACTCATACTTCCAAAGGG + Intronic
1023292209 7:38680241-38680263 CAGCCACTCTTTCTTCCATGAGG + Intergenic
1023507632 7:40917288-40917310 GAACTGCTCCTTCTTCTAAAGGG - Intergenic
1024157379 7:46639041-46639063 AAGACACTCCTTCTTCCAGGTGG + Intergenic
1024484757 7:49905663-49905685 GAGCCACTCCATCTTGAATAGGG + Intronic
1024494370 7:50027148-50027170 AAGGCACTCTCTCTTCCAAAGGG - Intronic
1026497978 7:70919899-70919921 GAGTCACTTCCCCTTCCAAAGGG + Intergenic
1029371880 7:100155497-100155519 GACCCAGGCCTCCTTCCAAATGG + Intronic
1030863321 7:114665653-114665675 GAACCATTACTTCTTCAAAATGG + Intronic
1032371661 7:131360031-131360053 GAGCCACTGCTTCTGGCCAATGG + Intronic
1033312774 7:140273749-140273771 GATGCACTCCTCTTTCCAAATGG + Intergenic
1036526571 8:9540497-9540519 GAGCCATTCCTTCATCCATTTGG - Intergenic
1036653212 8:10659022-10659044 CAGCCCCTCCTTCCTTCAAAGGG + Intronic
1036787863 8:11699721-11699743 GAGCCCCTCCCTATTCAAAAAGG + Intronic
1042159163 8:65874742-65874764 AAGCCACTCCCTCTGCCACAGGG - Intergenic
1044464722 8:92489686-92489708 TAGCTACTCCTGCTTCCACATGG - Intergenic
1045340969 8:101254204-101254226 TTGCCACTCCTTCTTTCAAGAGG - Intergenic
1049410176 8:142470467-142470489 GAGCCACTCCTTTTGCACAAGGG + Intronic
1049981820 9:910968-910990 GAGCCACTCAGTTTTCCTAAAGG - Intronic
1051769786 9:20564869-20564891 GAGCCATCCATTCTTCCACAAGG + Intronic
1052221955 9:26035280-26035302 GGGCCACTCTTTCCTCTAAATGG + Intergenic
1052802078 9:32978165-32978187 GAACCACTACTGCTTCAAAAGGG + Intronic
1053801567 9:41767239-41767261 CAGCCAGTCCTTCTTCCCATGGG - Intergenic
1054189998 9:61979393-61979415 CAGCCAGTCCTTCTTCCCATGGG - Intergenic
1054463408 9:65478922-65478944 CAGCCAGTCCTTCTTCCCATGGG + Intergenic
1054648516 9:67609198-67609220 CAGCCAGTCCTTCTTCCCATGGG + Intergenic
1057217931 9:93239778-93239800 GAGCCACGCCTTCTTCGCAGAGG + Exonic
1057696071 9:97323834-97323856 GAACCAGTTCTTCTTCCAGATGG + Exonic
1059015718 9:110513492-110513514 GAGCCACAGCTTCTTGCACATGG + Intronic
1060443870 9:123669565-123669587 GGTCCACTCCTTCCTTCAAATGG - Intronic
1060946812 9:127574550-127574572 GGGCCTCTCCTTCTTCCTACAGG - Intronic
1061876335 9:133546077-133546099 GGGACACTCTGTCTTCCAAAGGG - Intronic
1185525613 X:776078-776100 CAGACGCTACTTCTTCCAAAAGG - Intergenic
1185785807 X:2890019-2890041 GAGCCACTCCATCTTGAATAGGG - Intergenic
1185786022 X:2891603-2891625 GAGCCACTCCATCTTGAATAGGG - Intergenic
1186075026 X:5868962-5868984 GAGTCACTCCTTCCTGCCAAAGG - Intronic
1187229472 X:17406991-17407013 GGCCCAGTCCTTCTTCCACAGGG - Intronic
1187306056 X:18096288-18096310 GAGCAACTCCTTCTTGAATAGGG - Intergenic
1194815749 X:98439671-98439693 GAGCTACTGCTTCTTGGAAAGGG - Intergenic
1197375957 X:125682282-125682304 TAGACACACCTTCTGCCAAAAGG + Intergenic
1199727951 X:150603555-150603577 GTTCAACTCCATCTTCCAAATGG - Intronic
1200379478 X:155819787-155819809 GAGTGACTCCTGCTTCCATAAGG + Intergenic
1201288050 Y:12395801-12395823 GAGCCACTCCATCTTGAATAGGG + Intergenic