ID: 1007920137

View in Genome Browser
Species Human (GRCh38)
Location 6:45599936-45599958
Sequence CACTCAGTAGTGACCAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007920137 Original CRISPR CACTCAGTAGTGACCAGAGA GGG Intronic
902693604 1:18125969-18125991 CAGTTAGTAGTGACCAGGGGAGG + Intronic
904301585 1:29557795-29557817 CACTCCTTAGGGCCCAGAGAGGG + Intergenic
906947197 1:50305078-50305100 CACTCAATACAGACCAGACAAGG + Intergenic
908435462 1:64101365-64101387 CACTAAGTAATAACCAGATATGG + Intronic
908770437 1:67591029-67591051 CACTCAGAAGTGAAGGGAGATGG + Intergenic
909521476 1:76573498-76573520 CACTAAGTTCTGAGCAGAGAAGG - Intronic
909590861 1:77347461-77347483 CACTGAGTAATCCCCAGAGATGG - Intronic
909885408 1:80936063-80936085 TACTCAGGAGATACCAGAGACGG + Intergenic
909893116 1:81032788-81032810 CACTGTCTGGTGACCAGAGAGGG + Intergenic
912249906 1:108000421-108000443 CACACGGTAGTGACAAGTGAAGG - Intergenic
912656706 1:111492424-111492446 CACTCAGCATTGCTCAGAGATGG + Intronic
913494918 1:119419698-119419720 CAGTCAGTAGTGATCAGCAAAGG - Intronic
915305501 1:154975012-154975034 CTCTCAGTAGAGAGGAGAGAGGG + Intronic
915521374 1:156446664-156446686 CACTAAGCAGTGTCCAGAGTAGG - Intergenic
917374438 1:174334029-174334051 CACTCAGGAGAAACCAGAGAGGG + Intronic
917935054 1:179858239-179858261 CACTCTGTAGTGACAAAAAATGG - Intronic
922504054 1:226116228-226116250 CACTCAAGAGAGACCAGAGAGGG - Intergenic
922968300 1:229711139-229711161 CACTCAGCAGAGACCCCAGAAGG + Intergenic
1064454073 10:15470389-15470411 CACTCAGTAGACAAGAGAGAAGG - Intergenic
1074067650 10:110031693-110031715 CACTCACTAGGTACCAGATAGGG - Intronic
1074100204 10:110348700-110348722 CAGTCAGTGGTGACCAGAGGTGG - Intergenic
1079238816 11:18707995-18708017 CCCTGAGTAGTGACAGGAGATGG + Exonic
1080874359 11:36262750-36262772 CACTCAGCAGTGACATGAGTGGG + Intergenic
1082770291 11:57202536-57202558 CACCCAGGAGTGGCCAGAGCTGG + Intergenic
1087336055 11:96846200-96846222 CACTCACTAGTGAATAGAAAGGG + Intergenic
1087732934 11:101798936-101798958 CACTCTGTAGTCACTGGAGATGG - Intronic
1088460886 11:110081521-110081543 CAATCCGTGGAGACCAGAGAGGG - Intergenic
1089385527 11:118065037-118065059 AACTCAGAAATGACCAGATAAGG + Intergenic
1090852020 11:130579044-130579066 CACTCAGTGGTCACCTGAGAAGG + Intergenic
1090864744 11:130689771-130689793 CAAGCAGTAGTGACAAGAGCAGG + Intronic
1093175274 12:15906325-15906347 CAGTAAGAAGTGACAAGAGATGG - Intergenic
1096095316 12:48931431-48931453 CACCCTGGAGGGACCAGAGAAGG + Intronic
1096288320 12:50319563-50319585 CAATCTGCAGTGAGCAGAGATGG - Intergenic
1098156857 12:67608472-67608494 CACTCAGTACTAACCAATGATGG + Intergenic
1098471801 12:70853683-70853705 TAAGAAGTAGTGACCAGAGATGG - Intronic
1100038958 12:90288850-90288872 CTCTCAAGAGTGATCAGAGAGGG - Intergenic
1104913018 12:132249026-132249048 CACCCAGTAGAAACCTGAGAGGG - Intronic
1105759543 13:23501382-23501404 CACACAGTAGTGACAATAAACGG + Intergenic
1105923380 13:24985130-24985152 GACACAGCAGTGACCAGAGATGG - Intergenic
1106765283 13:32907259-32907281 CACTGAATAGTTAGCAGAGAGGG - Intergenic
1111893344 13:94110331-94110353 TACTCAGTAGAGAACACAGATGG + Intronic
1112174561 13:97009260-97009282 TACTCAGGAGTCACCAGAGTTGG - Intergenic
1113749577 13:112767977-112767999 CAGAGAGCAGTGACCAGAGAAGG - Intronic
1114291887 14:21295285-21295307 CCCTCAGTTGTGACCAGGGGAGG - Intronic
1114968812 14:28000771-28000793 CACTGAATAGGCACCAGAGAAGG + Intergenic
1119861870 14:77941935-77941957 CACCCAGCATTGAGCAGAGAAGG - Intergenic
1120422930 14:84311257-84311279 CACTGAGTATTGACAATAGAGGG - Intergenic
1122286175 14:100654138-100654160 CACTCTGTAATGATCAGAGTGGG + Intergenic
1122628027 14:103094162-103094184 CACTCAGAAGTGAGAAGGGACGG - Intergenic
1123952067 15:25288732-25288754 CAGTCAGTAAAGACCAGAGGGGG + Intergenic
1124009459 15:25825417-25825439 CACTCAGAAGGGACATGAGAGGG + Intronic
1127776823 15:62270367-62270389 CACCCAGGGGTGACCAGTGAGGG + Intergenic
1129537211 15:76323491-76323513 CACTCAGTAGTTACCAGCCTGGG + Intergenic
1129710442 15:77818141-77818163 GACTCAGGAGCAACCAGAGAAGG + Intronic
1129840480 15:78740410-78740432 CTCTCTGTAGTCATCAGAGAGGG - Intergenic
1130234597 15:82122472-82122494 AACCCAGTAGGGACCAGAAAGGG - Intergenic
1134019741 16:10913201-10913223 CACTGAGTAAAGACCAGAGGAGG - Intronic
1135926628 16:26699333-26699355 CTCTCAAGAGTAACCAGAGAGGG + Intergenic
1139813060 16:69639086-69639108 CATTCAGTATTGACAAGTGATGG + Intronic
1140495942 16:75388498-75388520 CACTGAGTAGGGACCACAAAAGG + Intronic
1142765976 17:2064606-2064628 CACTCAGGGGTGAACAGAGAAGG + Intronic
1146836484 17:36114880-36114902 CACTCAGCAGTGGCCATAGCCGG - Intergenic
1146972065 17:37081487-37081509 CACACAGGAGAGATCAGAGAAGG - Intergenic
1147019195 17:37517417-37517439 CAGTCAGGAATGGCCAGAGACGG + Exonic
1149863424 17:60137186-60137208 CACTCAGCTGGGACCACAGAAGG - Intergenic
1150258742 17:63771569-63771591 CACTCATTAGTAACTAAAGATGG - Intronic
1152736455 17:81999758-81999780 CACTCAGAAGTGGCCAGAGGAGG - Intronic
1152889429 17:82872038-82872060 TACTCAGTAGCGTCCGGAGAGGG + Intronic
1155500792 18:26484956-26484978 CTCTCAGTATTGACCTGAGCGGG + Intronic
1156010268 18:32489145-32489167 TCTTCAGTAGTGAACAGAGAGGG - Intergenic
1156118565 18:33816626-33816648 CACTCAGCAGTGGCCATAGCTGG - Intergenic
1156854025 18:41761119-41761141 CTCTCAGTAGGGACCCCAGAAGG + Intergenic
1158821977 18:61170754-61170776 CACTCTGCTGTGACCAGGGAGGG - Intergenic
1159691307 18:71491821-71491843 CAGTCAGTTGTGGCCAGGGAAGG - Intergenic
1160008669 18:75087887-75087909 TCCTCAGTTGTGAGCAGAGAAGG - Intergenic
1160431878 18:78818571-78818593 CACTCTGGAGTGAGCGGAGAGGG + Intergenic
1166386810 19:42387083-42387105 CTCCCAGGAGTGGCCAGAGAAGG + Exonic
1167153444 19:47723237-47723259 CACACAGCAGGGACCACAGAGGG + Intronic
1167904622 19:52648801-52648823 GACTCCGTAGTGACTAGAGCAGG - Intronic
927123040 2:19986454-19986476 GACTGAGGACTGACCAGAGAAGG + Intronic
930852176 2:55972994-55973016 CACTTAGTAGTGACCACGGTTGG + Intergenic
931288381 2:60851195-60851217 CACGCAGGAGTGAAGAGAGAGGG - Intergenic
933973775 2:87491439-87491461 GACTAAGTAATGACAAGAGATGG - Intergenic
936319949 2:111458770-111458792 GACTAAGTAATGACAAGAGATGG + Intergenic
940512621 2:154637867-154637889 CAATGAGTAGTTCCCAGAGAAGG - Intergenic
940592004 2:155740938-155740960 CACTGAATAGTGACCAAATACGG - Intergenic
940755593 2:157678193-157678215 CATTCAGTAGAGAACACAGAAGG + Intergenic
941922712 2:170867992-170868014 CACTGTGTAGTGACCAGTGTTGG + Intergenic
945903093 2:215560202-215560224 CATTCAGCAGTGACTAGGGAAGG + Intergenic
945907066 2:215605757-215605779 CACTTCATAGTGATCAGAGATGG - Intergenic
948740071 2:240040805-240040827 CAGTTGGTTGTGACCAGAGAAGG + Intergenic
1169282733 20:4280863-4280885 CACTCAGGGGAGAGCAGAGAGGG + Intergenic
1170088928 20:12568565-12568587 CACTCAGTAGTGGCAAGCCATGG + Intergenic
1172624088 20:36337486-36337508 CACTCAGTGCTGAGCTGAGATGG + Intronic
1172801321 20:37578331-37578353 CACTAAGCACTGAACAGAGATGG - Intergenic
1174885357 20:54328201-54328223 CACACAGTAGTAAACAGAGAAGG + Intergenic
1178312745 21:31543231-31543253 TACTCAGGAGAGATCAGAGAGGG - Intronic
1180206669 21:46265201-46265223 CTCTCAGGAGAGTCCAGAGAGGG - Intronic
1184506480 22:44906832-44906854 GACTCAGTGGTGATCAGAGTGGG + Intronic
1185005715 22:48275696-48275718 CACCCAGTAATGGCCAGAGCTGG + Intergenic
949589491 3:5479094-5479116 CACTCAGTAGGCACCAAAGCAGG - Intergenic
953851821 3:46470495-46470517 CACTCAGTAGGAGCCTGAGATGG + Intronic
955340253 3:58119953-58119975 CACTCAGCAGTAAACACAGACGG - Intronic
956325448 3:68047579-68047601 CACTCAGCTGTTAACAGAGAAGG - Intronic
957414401 3:79882622-79882644 CACTTAGAATGGACCAGAGAAGG + Intergenic
964644385 3:158942930-158942952 CTTTCAGTAGTGACCAATGAGGG - Intergenic
965635197 3:170773607-170773629 TCCTCAGTAGTCACCAGAAAAGG - Intronic
966326920 3:178767050-178767072 CAGTGAGTAGAGGCCAGAGAGGG + Intronic
967262276 3:187654544-187654566 CACTCAATTGTGTGCAGAGATGG + Intergenic
970053638 4:11946687-11946709 CAGTCATTAGAGACCTGAGAAGG - Intergenic
971178300 4:24302968-24302990 CTCTCAGTCAAGACCAGAGAAGG + Intergenic
975677632 4:76842721-76842743 CACTCAGTAGGGCCCAGAAAAGG - Intergenic
976526858 4:86102421-86102443 TACCCAGTAGTGACAACAGATGG - Intronic
978890398 4:113819718-113819740 AACTCAAGAGTGACCAGACATGG + Intergenic
979275019 4:118805860-118805882 CAATCTGTAGTGACCAGGGGAGG + Exonic
981643273 4:146969297-146969319 CACTCAGCAGTGGCCACAGGAGG - Intergenic
981998352 4:150999551-150999573 TAATCAGTAGTGACCAGGCACGG - Intronic
983698443 4:170561513-170561535 CAATCAGTAGTTGCCAGAGTTGG + Intergenic
983772269 4:171565655-171565677 CTCTCAGAACTGAACAGAGAAGG + Intergenic
984400142 4:179253008-179253030 CATTCAATAGTGATCAGATAAGG + Intergenic
984532018 4:180927849-180927871 CACTCAGTAGGCACCGGAGGAGG - Intergenic
985019810 4:185675442-185675464 TACTCAGCAGTGACGAGACACGG - Intronic
985580912 5:694603-694625 CACTCAGTGCTGCCCAGAGATGG + Intergenic
985595537 5:785935-785957 CACTCAGTGCTGCCCAGAGATGG + Intergenic
985759395 5:1737371-1737393 CCCTCAGCACTGAACAGAGACGG + Intergenic
985970067 5:3368822-3368844 AAATCAGTAGTGGCCAGACATGG - Intergenic
991568896 5:68034077-68034099 AACTCATTAGTGACTAGAGTGGG - Intergenic
992096810 5:73370335-73370357 ATCTCAGTAGTGTCTAGAGAGGG - Intergenic
993287758 5:86021981-86022003 CCCTCTTTAGTGACCACAGAAGG - Intergenic
994644726 5:102453965-102453987 CACTCAGGAGAGGTCAGAGATGG - Intronic
995529818 5:113081460-113081482 CACCCAGGAGAGACCAAAGAAGG - Intronic
997255989 5:132428383-132428405 CATACAGTAGTGAACAGACAAGG + Intronic
998147444 5:139738288-139738310 CGCAGAGCAGTGACCAGAGATGG + Intergenic
1001109854 5:168886599-168886621 TGCTCAGAAGTGACCTGAGAAGG + Intronic
1003400310 6:5785209-5785231 GACACAGCAGTGACCAGAGATGG - Intergenic
1004389552 6:15198597-15198619 GACTGAGGAGTGGCCAGAGAAGG + Intergenic
1004478897 6:16000261-16000283 TACTCTGGAGTGACCAGAGAAGG - Intergenic
1007026308 6:38578541-38578563 CCCACAGTTGTGACCAGAAAAGG + Intronic
1007759698 6:44126999-44127021 CGCTCCGGAGTGACCAGCGACGG + Exonic
1007920137 6:45599936-45599958 CACTCAGTAGTGACCAGAGAGGG + Intronic
1008562642 6:52737362-52737384 CACTCACTAGTGGCCAGGGGTGG - Intergenic
1011188966 6:84710758-84710780 CACCCAGAAGTGGCCAGTGAAGG - Intronic
1016854998 6:148658609-148658631 CACTCAGGAGACATCAGAGAAGG + Intergenic
1017935392 6:159000297-159000319 CACACAGCGGTGAGCAGAGAAGG - Intergenic
1025080571 7:55978732-55978754 CACTCAGAGCTGTCCAGAGATGG - Intronic
1025607168 7:63047707-63047729 CACAGAGTAATGACCAGAGCTGG - Intergenic
1028247683 7:88501263-88501285 TTCTCAGTAGTCAGCAGAGAAGG - Intergenic
1029280195 7:99430412-99430434 CACTCGCTATTGGCCAGAGAAGG + Intronic
1031836310 7:126685289-126685311 CACAGAGGGGTGACCAGAGAGGG + Intronic
1033427676 7:141259961-141259983 CACTCAGGAGAGATCAGAGAGGG - Intronic
1034712437 7:153205535-153205557 GACTCTGTAGTGACCAAATATGG + Intergenic
1037594276 8:20341692-20341714 GGCTCAGTGGTGACCACAGAAGG + Intergenic
1038928859 8:32170924-32170946 CTCTCATTAGTAACCAGAGCAGG + Intronic
1039445246 8:37625923-37625945 CAATCAGTTGTGACAAGCGAAGG + Intergenic
1039889170 8:41672705-41672727 TCCTCAGCAGTGACCAGAGAAGG + Exonic
1040484756 8:47859269-47859291 CCCTGAGGAGTGACCATAGATGG - Intronic
1042035655 8:64531306-64531328 CACACAGTAGGGACCCGACAAGG + Intergenic
1043096958 8:75987714-75987736 AACTCAGTAGTCCCCAAAGATGG + Intergenic
1044704768 8:94997878-94997900 CACTCAGTAGTTGTCAAAGAAGG - Intronic
1048128149 8:131660653-131660675 CACTAAGCAGTGGCAAGAGAGGG - Intergenic
1053282852 9:36832250-36832272 AACTCAGTAATTGCCAGAGATGG - Intergenic
1057855252 9:98596498-98596520 TCCTCAGGAGGGACCAGAGAGGG - Intronic
1060072274 9:120560435-120560457 CACTCACTATTGACCAGGAATGG + Intronic
1060819248 9:126651980-126652002 GCCTCGGTAGTGGCCAGAGATGG + Intronic
1062236177 9:135508885-135508907 CACTCAGGAAAAACCAGAGAGGG + Intergenic
1193524725 X:82575260-82575282 CTCTCAGAAGTGATGAGAGAAGG - Intergenic
1194162019 X:90465703-90465725 TGCTCAGAAGTGACCTGAGAAGG - Intergenic
1197228525 X:123978131-123978153 AACTCAGTAGTGGCCAGGCACGG - Intronic
1198140161 X:133794580-133794602 CAATGAGTAGAGACCAGAGGAGG - Intronic
1198214169 X:134542121-134542143 TATGCAGTAGTGACCAGAGCAGG - Intergenic
1200508299 Y:4043448-4043470 TGCTCAGAAGTGACCTGAGAAGG - Intergenic