ID: 1007921330

View in Genome Browser
Species Human (GRCh38)
Location 6:45612193-45612215
Sequence GTATTTATGGAGATTGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007921330_1007921336 -9 Left 1007921330 6:45612193-45612215 CCTCCCACAATCTCCATAAATAC 0: 1
1: 0
2: 2
3: 14
4: 191
Right 1007921336 6:45612207-45612229 CATAAATACAGGGAAAGCCATGG 0: 1
1: 0
2: 1
3: 17
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007921330 Original CRISPR GTATTTATGGAGATTGTGGG AGG (reversed) Intronic
902149055 1:14427702-14427724 GAATTTAAGGAGAATGTGGTTGG + Intergenic
904614445 1:31742413-31742435 GTATTTCTGGAGCTGGTGGCAGG - Intronic
904910747 1:33932376-33932398 GTATTTAAGGGGAATGAGGGTGG + Intronic
908015634 1:59831246-59831268 CTATTTTTGGCTATTGTGGGGGG + Intronic
908509059 1:64836667-64836689 GTATATAAGGAGATTGGGTGCGG - Intronic
911602510 1:99862059-99862081 GTAATTATGTAGATTGTGAAAGG + Intronic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915047515 1:153030786-153030808 GTATTTCTGGTTATTCTGGGAGG - Intergenic
915248601 1:154572770-154572792 ATATTTATGGAGATGGGGGTGGG + Intronic
917351854 1:174086491-174086513 AAATTTATTGAGATTTTGGGGGG + Intergenic
920647270 1:207812809-207812831 ACATATATGGAGATTGTGTGGGG - Intergenic
920797457 1:209154284-209154306 GTCCTTATGGAGAGTGTGAGGGG - Intergenic
921129877 1:212210583-212210605 GTATTTCTGGAGTTTGTGTTGGG - Intergenic
921920696 1:220666108-220666130 GTTTTTTTGGAGATGGAGGGGGG - Intergenic
922140691 1:222883262-222883284 GTATATATGTACATTGTTGGTGG - Intronic
922540788 1:226417665-226417687 TTATTTATGTAGATTTTGGTTGG + Intergenic
924821256 1:247492774-247492796 TTATTTGTGGAGGTTGGGGGTGG - Intergenic
1064146617 10:12830908-12830930 GTGTTTATTGAGAGGGTGGGGGG - Exonic
1070484003 10:76912457-76912479 GTATTTGTGGGGGATGTGGGAGG + Intronic
1072770370 10:98132876-98132898 GTTTTTATGGACATTTTGGTGGG + Intergenic
1075154929 10:119967362-119967384 GTTTTTAAGGAGATTGTGGAGGG + Intergenic
1077665588 11:4105725-4105747 TTATCTGTGGAGATTGGGGGCGG + Intronic
1077838271 11:5944446-5944468 ATGTGTATGGAGAGTGTGGGTGG + Intergenic
1080198695 11:29643037-29643059 ATATTTATGGTGTTTGTGGTGGG - Intergenic
1081863405 11:46347062-46347084 GTATGGGTGGAGATTGTGAGTGG + Intronic
1083180507 11:60981996-60982018 GTCCTGATGGAGATTGGGGGTGG - Intronic
1084207274 11:67602973-67602995 TTTTTTAAGGAGATTGTGGAGGG + Exonic
1088680532 11:112237798-112237820 GGAATTGTGGAGTTTGTGGGTGG + Intronic
1089909096 11:122077698-122077720 TTATTTAAGGAAAGTGTGGGTGG + Intergenic
1091247601 11:134111948-134111970 GTGATTATGGAGGTTGTGGTAGG - Intronic
1091608208 12:1976745-1976767 GTATATATGCAAATTTTGGGAGG + Intronic
1091651430 12:2313187-2313209 GGATTGATGGAGAGTGTGCGAGG + Intronic
1095425497 12:42070491-42070513 TTATTTATTGAGATTGTGGGCGG - Intergenic
1095492196 12:42746446-42746468 GTTTTTATGGACAATGTGGTGGG - Intergenic
1098330280 12:69345509-69345531 TTATTTATGGTGAGTGTTGGGGG - Intergenic
1098442869 12:70536454-70536476 GTATTTGTGTAGACTGTTGGAGG + Intronic
1099099210 12:78416360-78416382 TTTTCTATGGAGATTCTGGGTGG - Intergenic
1099344777 12:81484423-81484445 GGATTAATGGTGACTGTGGGAGG + Intronic
1099924938 12:89005824-89005846 GTAACTATGGAAAGTGTGGGAGG + Intergenic
1100251546 12:92829995-92830017 ATTTTTAGGGAGAGTGTGGGGGG + Intronic
1100372260 12:93979110-93979132 GTATTAATGGAGATTGAGTGCGG + Intergenic
1101563450 12:105882068-105882090 CTGTCCATGGAGATTGTGGGAGG - Intergenic
1102580402 12:113882740-113882762 GCTTTTATGTAGATTTTGGGTGG - Intronic
1103967333 12:124648091-124648113 GGATTTATGGAAACAGTGGGGGG - Intergenic
1106670506 13:31899721-31899743 GAATTTATTAAGATTGTGGAAGG + Intergenic
1106793799 13:33183791-33183813 ATATTCAGGGAGATTTTGGGTGG - Intronic
1106868491 13:33993616-33993638 GTCTATATGGTGATGGTGGGAGG + Intergenic
1108611055 13:52084070-52084092 GTATTTATGGAAGAAGTGGGTGG - Intronic
1108839068 13:54589910-54589932 GTGTTTGTGGAGATTGAAGGAGG - Intergenic
1109853481 13:68099738-68099760 GGTTTTATGGGGATTGTGGTGGG + Intergenic
1112417759 13:99217697-99217719 GTCTCTGTGGAGGTTGTGGGGGG + Intronic
1114747111 14:25160968-25160990 GTATTAAGTGAGATTGTGGATGG + Intergenic
1114958049 14:27848338-27848360 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1116233511 14:42248292-42248314 GTCTTTAAGGAGATTATGGAGGG + Intergenic
1118122564 14:62861619-62861641 GTGTAAATGGAGATGGTGGGGGG - Intronic
1120073896 14:80134265-80134287 GAATTCATGGAGATGCTGGGAGG + Intergenic
1120660442 14:87242546-87242568 TTATTAATGGACATTTTGGGTGG - Intergenic
1120751283 14:88200953-88200975 GTAAATATGGAGACTGTGGTAGG - Intronic
1121010596 14:90517946-90517968 GTGTTTAGGGAGACAGTGGGCGG + Intergenic
1121293653 14:92798408-92798430 TTATTTGTGGAGGATGTGGGGGG - Intronic
1121773147 14:96570276-96570298 GTATGTATGGGGATTGAGAGGGG - Intergenic
1123180813 14:106468490-106468512 GAATTTCTGGAGATTCTGAGTGG + Intergenic
1202946084 14_KI270726v1_random:28168-28190 GAATTTCTGGAGATTCTGAGTGG - Intergenic
1129933182 15:79429027-79429049 GTATTTAGAGAGAATTTGGGGGG + Intergenic
1130741586 15:86606285-86606307 GTTTCTAAGGAGATTGTGGAAGG - Intronic
1132830360 16:1924997-1925019 TTATTCATGGAGGTTGGGGGAGG - Intergenic
1134453848 16:14379690-14379712 GTCTTTCTGGAGATCCTGGGAGG + Intergenic
1134595888 16:15495722-15495744 GTATTTGTGGACATTGCAGGTGG + Intronic
1138284039 16:55794345-55794367 GTATTGTTGGAAATTGTTGGGGG - Intergenic
1138284963 16:55802642-55802664 GTATTGTTGGAAATTGTTGGGGG + Intergenic
1140015123 16:71175099-71175121 GTATTTGTAGAGTTGGTGGGTGG - Intronic
1140755265 16:78060808-78060830 GTATTTTGGGAGGTTGTGGCAGG - Intronic
1143664958 17:8352204-8352226 GTGTTTTTGGAGATGGTGGGGGG + Intergenic
1149133972 17:53342526-53342548 GCACTTATGGAGATTGTAGTGGG - Intergenic
1149469665 17:56905825-56905847 GTATTCCTGGAGAGTGGGGGTGG + Intronic
1151114491 17:71719173-71719195 GTATTTATGAAGTTTGTTGTAGG - Intergenic
1151212146 17:72552695-72552717 GTTTTTATGCAGCTGGTGGGAGG - Intergenic
1157168220 18:45377987-45378009 TTTTTTATGGTGATTGTTGGGGG - Intronic
1157885544 18:51362751-51362773 GTATTTATGGAGATAGTAGAAGG - Intergenic
1159097822 18:63924649-63924671 GCATTCATGGAGCTTGTTGGGGG - Intronic
1161595035 19:5146760-5146782 TTTTTTGTAGAGATTGTGGGGGG - Intronic
1166951652 19:46432437-46432459 GCATTTTTGGAGATTGAGGCAGG - Intergenic
1168639217 19:58019735-58019757 GTTCATATGGAGATTCTGGGAGG - Intergenic
925055731 2:855643-855665 GTATTTAGGGAGATGGAGAGTGG - Intergenic
925521767 2:4754426-4754448 GTATTTGTGGGGGTTGAGGGGGG + Intergenic
927511564 2:23647264-23647286 ATATTTATGGAGGCTGTGGAAGG - Intronic
928690157 2:33791191-33791213 CAATTTATGGAGATGGAGGGGGG - Intergenic
930834518 2:55779007-55779029 GTATTTATTGAGAATCTGTGTGG + Intergenic
932961388 2:76416021-76416043 GTTTTTATGGGGTTTGTGGGAGG - Intergenic
933177487 2:79191916-79191938 GGATTCATGGAGGTTGTGTGAGG - Intronic
934150135 2:89138680-89138702 TTATTTATGAATATTCTGGGTGG + Intergenic
934217159 2:90043359-90043381 TTATTTATGAATATTCTGGGTGG - Intergenic
934479252 2:94619706-94619728 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
939131841 2:138244447-138244469 GTTTTTATGGATAATGTGGTAGG + Intergenic
940409735 2:153347319-153347341 GGATGTGTGGAGATTGTGGGAGG + Intergenic
941365495 2:164606168-164606190 GGATGTGTGGGGATTGTGGGAGG - Intronic
941391616 2:164921943-164921965 GTGTTTATGGGGGTTGTGGTTGG + Intronic
948619299 2:239224090-239224112 GAATTCATGGGGAATGTGGGTGG - Intronic
1170858831 20:20083720-20083742 TTATTCATGAAGATTGTTGGGGG - Intronic
1174525017 20:51163662-51163684 TTATTTGTAGAGATGGTGGGGGG - Intergenic
1175124609 20:56741953-56741975 GTCTTTATGGGGATTGAGGGTGG + Intergenic
1176052067 20:63125099-63125121 GTATTTGGGGAGATAGCGGGAGG + Intergenic
1177946897 21:27481544-27481566 GTATTTATATGGAGTGTGGGGGG + Intergenic
1183310039 22:37104631-37104653 GTATTTATGGATATAGTAAGAGG - Intronic
1183369490 22:37424467-37424489 CTGTTTCTGGAGCTTGTGGGTGG + Intronic
950420039 3:12892982-12893004 GTCTCTGTGGAGGTTGTGGGTGG - Intergenic
951168492 3:19510254-19510276 GTATGTACAGAGTTTGTGGGAGG - Intronic
952128247 3:30328783-30328805 ATAGTTATGGAGGTTGTGTGTGG + Intergenic
955410832 3:58654373-58654395 GAATTGATGGAAACTGTGGGGGG - Intronic
957665149 3:83217695-83217717 GGATTTACGGAGAAGGTGGGCGG + Intergenic
958557479 3:95699013-95699035 AAATTTATGGAGATTGTGGGAGG - Intergenic
958737199 3:98023252-98023274 GTTTTTATGGAGATTATTTGAGG - Intronic
961106474 3:124246797-124246819 GTGTTTCTGGAGTTTGTGGTAGG + Intronic
963328186 3:143884977-143884999 GTATTTCTGGAAGTTGTAGGTGG + Intergenic
963947092 3:151158086-151158108 GCATTTTTGGAAATTGTAGGGGG + Intronic
965206876 3:165730110-165730132 GTACTCATCGAGATTGAGGGTGG + Intergenic
965556956 3:170028294-170028316 GCATTTATGGAGACTGAGGTGGG + Intergenic
966631574 3:182081707-182081729 GTATGCATGGGGATAGTGGGGGG + Intergenic
971448644 4:26779217-26779239 GTATTTATTGACATTGTTGAAGG - Intergenic
972049358 4:34709604-34709626 GTATATATGGACACAGTGGGAGG - Intergenic
977028185 4:91847589-91847611 GTATTTATAGACATTGTGATAGG + Intergenic
979585809 4:122415570-122415592 GTTTCTTTGGAGATTGTGGATGG + Exonic
980084960 4:128381308-128381330 CTATTTATGGATGTTGTGGAGGG + Intergenic
981851869 4:149240943-149240965 GTATTTATGGAGGCTGAGGTGGG + Intergenic
982221344 4:153127923-153127945 GTGTTCGTGGAGATTATGGGAGG + Intergenic
983518329 4:168679519-168679541 GTATGTATGGATATGGTGTGTGG + Intronic
984452182 4:179916182-179916204 AAAGTTATGGAGATTGAGGGTGG - Intergenic
986640355 5:9865935-9865957 GTATTTTTCAAGATTTTGGGAGG - Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
993477180 5:88380216-88380238 GTATTTATTGAGTGTGTGGCAGG - Intergenic
994085214 5:95750750-95750772 GTCTTTATGGGGAATGGGGGAGG + Intronic
994931937 5:106200129-106200151 ATATTTATGGTGTGTGTGGGAGG - Intergenic
995006223 5:107199053-107199075 GTTTTTGTGGAGAATGTGGTAGG + Intergenic
997610227 5:135210557-135210579 GGTTTTATGGAGTTTGGGGGTGG + Intronic
1000956100 5:167545262-167545284 TTATCTATGGAGGTTGTGGTTGG - Intronic
1003230597 6:4249472-4249494 GTATTTATGCAGATTATTTGAGG + Intergenic
1003349241 6:5300570-5300592 GTCTGTGTGGAGATGGTGGGTGG + Intronic
1007921330 6:45612193-45612215 GTATTTATGGAGATTGTGGGAGG - Intronic
1008449658 6:51635842-51635864 GTATTTGTGGTGAAGGTGGGGGG + Intronic
1008963827 6:57294124-57294146 GTATTTATTGATATTGCAGGAGG + Intergenic
1009747655 6:67839464-67839486 GTATCGGTGAAGATTGTGGGAGG - Intergenic
1013374823 6:109504182-109504204 GTTTTTATAGAGATTGGAGGGGG - Intronic
1013420083 6:109959631-109959653 GCATTAATGGAGATTGAGGGGGG - Intergenic
1016441481 6:144088980-144089002 GTTTTTAGGGATATGGTGGGGGG - Intergenic
1018572269 6:165224230-165224252 GTAGTTCAGGAGATTGTGAGTGG + Intergenic
1021893054 7:25206084-25206106 GATTTCATGGAGATTGTGGAGGG + Intergenic
1023138046 7:37073371-37073393 GTATTTATGCAGATAATGTGAGG + Intronic
1023420851 7:39977999-39978021 GTATTTAAGGAGAAGGAGGGTGG + Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027308050 7:76922591-76922613 GTCAATATGGAGATTGTGGTAGG + Intergenic
1029738791 7:102479724-102479746 TTATTTTTGGAGATGGTGGGGGG + Intergenic
1029755916 7:102573380-102573402 TTATTTTTGGAGATGGTGGGGGG + Intronic
1029773858 7:102672453-102672475 TTATTTTTGGAGATGGTGGGGGG + Intergenic
1030172410 7:106616542-106616564 GTAGGTATGGAGAGGGTGGGAGG + Intergenic
1030284864 7:107815395-107815417 ATATATATGGAGGGTGTGGGTGG + Intergenic
1031931802 7:127693258-127693280 TTATTTTTGGAGATTGGGGTGGG + Intronic
1031938669 7:127763845-127763867 GTATTTGGGGAGACTGAGGGAGG + Intronic
1032835821 7:135672423-135672445 GTATTTATGTGGGTTGTGAGGGG + Intronic
1032872587 7:136002137-136002159 GTATTTGAGTAGATTGTTGGAGG + Intergenic
1033062971 7:138125520-138125542 GTATTTCTGGTGATTGAGGCAGG - Intergenic
1033534275 7:142297951-142297973 GTGTATATGGAGGTTGTTGGAGG + Intergenic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034055760 7:148033299-148033321 GTGTCTCTGGAGATTGGGGGTGG - Intronic
1034932622 7:155174458-155174480 GCATATATGGTGATTGTGGTGGG + Intergenic
1035755667 8:2029973-2029995 GTAATTATGGAGGTGCTGGGTGG + Intergenic
1036680862 8:10872266-10872288 GTTTTTAGGGAGACTTTGGGAGG - Intergenic
1037114667 8:15209947-15209969 GCAGTTATGGAGTTTCTGGGAGG + Intronic
1038280104 8:26156375-26156397 GTATTTATGGATAATTTGGTGGG + Intergenic
1038433280 8:27516583-27516605 GTATTCATTCAGAGTGTGGGGGG - Intronic
1039126341 8:34206018-34206040 GTATTTTGGGAGATTGAGGCAGG + Intergenic
1039395599 8:37222706-37222728 GTATTTATTGAGTTTGTGTCAGG + Intergenic
1041038931 8:53826388-53826410 GTAATGATGGACATTGTGGTTGG - Intronic
1043447323 8:80331719-80331741 GTGTTTATCCAGATTGTGAGGGG + Intergenic
1044823301 8:96173454-96173476 GTATTTCTGGGGATTCTTGGAGG + Intergenic
1045751080 8:105484802-105484824 TCATCTATGGAAATTGTGGGTGG + Intronic
1046527314 8:115397093-115397115 GTATTTCTGGATATTATTGGTGG - Intergenic
1046606584 8:116378244-116378266 GTATTGATTGGGATTGTGGCAGG - Intergenic
1046815364 8:118577419-118577441 GTATATATGTGGATTGGGGGAGG - Intronic
1047346370 8:124032565-124032587 GTATTTATTGATTTTTTGGGAGG - Intronic
1047851198 8:128859380-128859402 GTATTTATGGAGCTTAAGGCGGG + Intergenic
1049981537 9:908511-908533 CAATTTATGGAAATTGCGGGAGG + Intronic
1050663867 9:7913252-7913274 TTTTCTATGGACATTGTGGGTGG + Intergenic
1051062771 9:13064310-13064332 GTAATTATACAGATTGGGGGTGG + Intergenic
1051980770 9:23013280-23013302 TTATTTATGGAGATTCTGTTTGG - Intergenic
1052178606 9:25497287-25497309 GTTTTTATGGAGATTTCTGGTGG - Intergenic
1053678577 9:40463859-40463881 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1053928562 9:43092213-43092235 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054285147 9:63161083-63161105 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1054291655 9:63299397-63299419 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054389671 9:64603940-64603962 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054506041 9:65912436-65912458 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1056415253 9:86369141-86369163 GTTTTTAAGGAGATTTTGGAGGG + Intergenic
1056579287 9:87878724-87878746 GTTTTTAAGGAGATTGTGGAGGG - Intergenic
1057414215 9:94846976-94846998 ATATTTATTGAGGTGGTGGGAGG + Intronic
1058791693 9:108453003-108453025 ATAGTTATGGAGGTTGTGTGTGG - Intergenic
1059384762 9:113955571-113955593 ATATTTATAGAGATTGTGGTTGG + Intronic
1061221241 9:129253420-129253442 GTATTTGTGGAGCTGATGGGAGG + Intergenic
1189269431 X:39740501-39740523 GAACTTGTGGACATTGTGGGGGG - Intergenic
1191654019 X:63576466-63576488 GTGTTTATGGACTTTGTGGAAGG + Intergenic
1191851982 X:65591930-65591952 GTATTAATGGTGATTGTCTGTGG + Intronic
1193949954 X:87785489-87785511 AATTTTATGGAAATTGTGGGAGG - Intergenic
1196548025 X:116987960-116987982 GTATTTGGGGCAATTGTGGGAGG - Intergenic
1197100170 X:122643967-122643989 GTAGTGATGGAGATGGTGAGAGG - Intergenic
1198176315 X:134159173-134159195 GTATTTATGGAGATTCTCGCTGG - Intergenic
1199335276 X:146612030-146612052 GTATTAATGGAGGTTTTGGTGGG + Intergenic
1201479573 Y:14425285-14425307 GTACTTATGTACATTGTAGGAGG + Intergenic