ID: 1007928186

View in Genome Browser
Species Human (GRCh38)
Location 6:45667214-45667236
Sequence ACTCACATGGTGTATGAGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007928182_1007928186 24 Left 1007928182 6:45667167-45667189 CCAGAAGAGAGATGTGCAAAACC No data
Right 1007928186 6:45667214-45667236 ACTCACATGGTGTATGAGTCCGG No data
1007928183_1007928186 3 Left 1007928183 6:45667188-45667210 CCATGCTGAAGAGATGAATCATG No data
Right 1007928186 6:45667214-45667236 ACTCACATGGTGTATGAGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007928186 Original CRISPR ACTCACATGGTGTATGAGTC CGG Intergenic
No off target data available for this crispr