ID: 1007928186 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:45667214-45667236 |
| Sequence | ACTCACATGGTGTATGAGTC CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1007928182_1007928186 | 24 | Left | 1007928182 | 6:45667167-45667189 | CCAGAAGAGAGATGTGCAAAACC | No data | ||
| Right | 1007928186 | 6:45667214-45667236 | ACTCACATGGTGTATGAGTCCGG | No data | ||||
| 1007928183_1007928186 | 3 | Left | 1007928183 | 6:45667188-45667210 | CCATGCTGAAGAGATGAATCATG | No data | ||
| Right | 1007928186 | 6:45667214-45667236 | ACTCACATGGTGTATGAGTCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1007928186 | Original CRISPR | ACTCACATGGTGTATGAGTC CGG | Intergenic | ||
| No off target data available for this crispr | |||||