ID: 1007930232

View in Genome Browser
Species Human (GRCh38)
Location 6:45684276-45684298
Sequence TATTTCAAATGGGGGTATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007930232_1007930242 18 Left 1007930232 6:45684276-45684298 CCATAATACCCCCATTTGAAATA No data
Right 1007930242 6:45684317-45684339 ACTGCTCAAAGTCATATAGGTGG No data
1007930232_1007930241 15 Left 1007930232 6:45684276-45684298 CCATAATACCCCCATTTGAAATA No data
Right 1007930241 6:45684314-45684336 CAAACTGCTCAAAGTCATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007930232 Original CRISPR TATTTCAAATGGGGGTATTA TGG (reversed) Intergenic
No off target data available for this crispr