ID: 1007930237

View in Genome Browser
Species Human (GRCh38)
Location 6:45684287-45684309
Sequence CCATTTCCTTATATTTCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007930237_1007930242 7 Left 1007930237 6:45684287-45684309 CCATTTGAAATATAAGGAAATGG No data
Right 1007930242 6:45684317-45684339 ACTGCTCAAAGTCATATAGGTGG No data
1007930237_1007930243 24 Left 1007930237 6:45684287-45684309 CCATTTGAAATATAAGGAAATGG No data
Right 1007930243 6:45684334-45684356 AGGTGGCAAGTAACAAAGTTTGG No data
1007930237_1007930241 4 Left 1007930237 6:45684287-45684309 CCATTTGAAATATAAGGAAATGG No data
Right 1007930241 6:45684314-45684336 CAAACTGCTCAAAGTCATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007930237 Original CRISPR CCATTTCCTTATATTTCAAA TGG (reversed) Intergenic
No off target data available for this crispr