ID: 1007930241

View in Genome Browser
Species Human (GRCh38)
Location 6:45684314-45684336
Sequence CAAACTGCTCAAAGTCATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007930234_1007930241 7 Left 1007930234 6:45684284-45684306 CCCCCATTTGAAATATAAGGAAA No data
Right 1007930241 6:45684314-45684336 CAAACTGCTCAAAGTCATATAGG No data
1007930237_1007930241 4 Left 1007930237 6:45684287-45684309 CCATTTGAAATATAAGGAAATGG No data
Right 1007930241 6:45684314-45684336 CAAACTGCTCAAAGTCATATAGG No data
1007930236_1007930241 5 Left 1007930236 6:45684286-45684308 CCCATTTGAAATATAAGGAAATG No data
Right 1007930241 6:45684314-45684336 CAAACTGCTCAAAGTCATATAGG No data
1007930232_1007930241 15 Left 1007930232 6:45684276-45684298 CCATAATACCCCCATTTGAAATA No data
Right 1007930241 6:45684314-45684336 CAAACTGCTCAAAGTCATATAGG No data
1007930235_1007930241 6 Left 1007930235 6:45684285-45684307 CCCCATTTGAAATATAAGGAAAT No data
Right 1007930241 6:45684314-45684336 CAAACTGCTCAAAGTCATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007930241 Original CRISPR CAAACTGCTCAAAGTCATAT AGG Intergenic
No off target data available for this crispr